Incidental Mutation 'R6285:Pcdhgc5'
ID508208
Institutional Source Beutler Lab
Gene Symbol Pcdhgc5
Ensembl Gene ENSMUSG00000102543
Gene Nameprotocadherin gamma subfamily C, 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R6285 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37819513-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37820621 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 316 (Y316F)
Ref Sequence ENSEMBL: ENSMUSP00000060949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000044851] [ENSMUST00000055935] [ENSMUST00000061279] [ENSMUST00000066140] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000076807] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192103] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000193404] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000193890] [ENSMUST00000193941] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000194928] [ENSMUST00000195112] [ENSMUST00000195239] [ENSMUST00000195363] [ENSMUST00000195764] [ENSMUST00000195823] [ENSMUST00000208907]
Predicted Effect probably benign
Transcript: ENSMUST00000003599
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044851
SMART Domains Protein: ENSMUSP00000036359
Gene: ENSMUSG00000102428

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
CA 45 131 3.28e-1 SMART
CA 155 240 1.8e-17 SMART
CA 264 345 9.22e-24 SMART
CA 369 450 1.28e-22 SMART
CA 474 560 1.09e-25 SMART
CA 591 669 9.24e-15 SMART
Pfam:Cadherin_C_2 688 772 3.6e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055935
AA Change: Y316F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000060949
Gene: ENSMUSG00000102543
AA Change: Y316F

DomainStartEndE-ValueType
CA 54 131 3.02e-2 SMART
CA 155 240 6.84e-18 SMART
CA 264 348 7.91e-23 SMART
CA 372 452 4.4e-21 SMART
CA 476 562 3.31e-25 SMART
CA 592 674 5.69e-15 SMART
Pfam:Cadherin_C_2 689 791 1.1e-18 PFAM
low complexity region 808 819 N/A INTRINSIC
Pfam:Cadherin_tail 821 944 8.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061279
SMART Domains Protein: ENSMUSP00000058362
Gene: ENSMUSG00000102742

DomainStartEndE-ValueType
CA 45 131 3.23e-2 SMART
CA 155 240 2.22e-17 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 7.09e-25 SMART
CA 474 560 3.55e-25 SMART
CA 591 669 2.53e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 914 933 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066140
SMART Domains Protein: ENSMUSP00000068846
Gene: ENSMUSG00000023036

DomainStartEndE-ValueType
CA 52 134 4.39e-1 SMART
CA 158 243 1.25e-20 SMART
CA 267 351 5.09e-26 SMART
CA 375 456 1.26e-21 SMART
CA 480 566 6.56e-29 SMART
CA 596 674 6.95e-10 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 922 941 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076807
SMART Domains Protein: ENSMUSP00000076085
Gene: ENSMUSG00000102918

DomainStartEndE-ValueType
low complexity region 20 26 N/A INTRINSIC
CA 51 133 8.56e-3 SMART
CA 157 242 1.78e-16 SMART
CA 266 350 2.18e-25 SMART
CA 374 455 7.09e-25 SMART
CA 479 565 1.87e-24 SMART
CA 593 674 1.79e-12 SMART
Pfam:Cadherin_C_2 689 774 3.9e-14 PFAM
Pfam:Cadherin_tail 811 934 8.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091935
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192103
SMART Domains Protein: ENSMUSP00000141611
Gene: ENSMUSG00000102918

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_2 31 78 2.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192109
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192875
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193222
Predicted Effect probably benign
Transcript: ENSMUST00000193404
SMART Domains Protein: ENSMUSP00000141359
Gene: ENSMUSG00000102222

DomainStartEndE-ValueType
CA 43 129 2.76e-2 SMART
CA 153 238 1.16e-20 SMART
CA 262 343 1.25e-25 SMART
CA 367 448 4.75e-26 SMART
CA 472 558 3.69e-23 SMART
CA 589 667 3.84e-12 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193890
Predicted Effect probably benign
Transcript: ENSMUST00000193941
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194068
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194928
SMART Domains Protein: ENSMUSP00000141997
Gene: ENSMUSG00000104063

DomainStartEndE-ValueType
CA 47 131 2.48e-6 SMART
CA 155 240 1.57e-17 SMART
CA 264 343 1.29e-27 SMART
CA 367 448 9.14e-28 SMART
CA 472 558 1.24e-24 SMART
CA 589 670 3.73e-10 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 716 721 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194980
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195239
SMART Domains Protein: ENSMUSP00000141244
Gene: ENSMUSG00000023036

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195764
SMART Domains Protein: ENSMUSP00000142272
Gene: ENSMUSG00000103081

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 57 132 1.5e-4 SMART
CA 156 241 1.2e-20 SMART
CA 265 346 7.8e-29 SMART
CA 370 451 1.7e-26 SMART
CA 475 561 2.2e-26 SMART
CA 592 673 6.4e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208907
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,072,224 K28R probably benign Het
Acad9 A T 3: 36,082,175 M370L probably benign Het
Aimp1 A G 3: 132,667,504 M225T possibly damaging Het
Atp8a1 T C 5: 67,667,607 I809V possibly damaging Het
Bbs10 A G 10: 111,299,761 Y245C probably damaging Het
Cabin1 A T 10: 75,684,323 F1572Y probably damaging Het
Cd79a A G 7: 24,899,347 N107S possibly damaging Het
Cdc7 G A 5: 106,983,059 A428T probably benign Het
Cep290 A G 10: 100,523,329 T974A probably benign Het
Cep350 A T 1: 155,953,374 N261K possibly damaging Het
Cfap46 T A 7: 139,661,085 D8V probably damaging Het
Col6a4 T C 9: 106,074,986 D571G probably damaging Het
Cpe A C 8: 64,617,611 V200G probably benign Het
Ctnnd1 C T 2: 84,613,887 probably null Het
D5Ertd579e A C 5: 36,615,577 C491W probably damaging Het
Dek A G 13: 47,099,380 I183T probably damaging Het
Dennd1a A T 2: 37,852,441 H437Q possibly damaging Het
Dido1 C T 2: 180,661,147 A1655T probably benign Het
Eva1b A G 4: 126,149,485 D106G probably damaging Het
Evc2 G T 5: 37,424,579 S1189I possibly damaging Het
Faap100 A T 11: 120,376,732 L405Q probably damaging Het
Fbxw15 T A 9: 109,557,166 M249L probably benign Het
Gbp10 A T 5: 105,218,460 L526Q probably damaging Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm14025 T G 2: 129,037,799 T736P possibly damaging Het
Gm19402 A C 10: 77,690,520 probably benign Het
Gm2244 A G 14: 19,540,797 Y141H probably damaging Het
Gm4181 A T 14: 51,633,209 N98K probably damaging Het
Gm765 T C 6: 98,238,173 D163G probably damaging Het
Golga4 C T 9: 118,558,627 R616* probably null Het
Gpank1 T A 17: 35,124,290 S226T probably damaging Het
Hipk3 T C 2: 104,471,425 M141V probably damaging Het
Hoxc11 T C 15: 102,954,743 V73A probably benign Het
Igf1r T G 7: 68,004,137 I141S possibly damaging Het
Jak2 T A 19: 29,295,659 F628I probably benign Het
Kcp C A 6: 29,502,365 V227L probably benign Het
Knl1 T G 2: 119,071,941 C1374W probably damaging Het
Larp6 A T 9: 60,737,760 R394S probably benign Het
Lilra5 G A 7: 4,242,115 G253R probably damaging Het
Map3k4 A G 17: 12,264,058 S591P probably damaging Het
Mrpl16 T A 19: 11,772,968 I72K probably damaging Het
Nol11 C G 11: 107,181,034 R244S probably benign Het
Nr2f1 T C 13: 78,195,663 T161A probably benign Het
Nrd1 G T 4: 109,038,006 V476F probably damaging Het
Olfr1406 G T 1: 173,183,910 H175N probably damaging Het
Olfr419 A T 1: 174,250,829 S33T possibly damaging Het
Olfr451-ps1 A T 6: 42,800,909 H56L probably benign Het
Olfr535 T A 7: 140,492,713 L25Q possibly damaging Het
P2rx1 A G 11: 73,008,148 I62V probably benign Het
Pecam1 T C 11: 106,685,239 D490G probably benign Het
Pfkfb2 A T 1: 130,707,562 Y87* probably null Het
Poldip2 A G 11: 78,517,632 probably null Het
Ppp2r5b T A 19: 6,230,536 Q304L probably benign Het
Psg26 A G 7: 18,482,828 F29L probably benign Het
Ptk6 A T 2: 181,197,093 L289Q probably null Het
Ptprt A T 2: 161,901,497 I508N possibly damaging Het
Rasgrp4 T C 7: 29,148,383 F406S probably damaging Het
Rspo3 A G 10: 29,499,930 probably null Het
Sept8 G T 11: 53,534,767 probably null Het
Sirt2 A C 7: 28,788,046 T345P probably benign Het
Slc6a20b T C 9: 123,609,096 E205G possibly damaging Het
Sqstm1 G A 11: 50,202,591 Q327* probably null Het
Susd3 T A 13: 49,237,521 S98C probably damaging Het
Tada2b G A 5: 36,476,842 R56W probably damaging Het
Tbc1d2 A T 4: 46,615,045 V546E possibly damaging Het
Tbx6 A G 7: 126,781,568 Q21R possibly damaging Het
Usp24 T G 4: 106,374,100 probably null Het
Vmn2r103 A G 17: 19,812,144 T727A probably benign Het
Wdr48 C T 9: 119,920,610 T531M probably damaging Het
Other mutations in Pcdhgc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Pcdhgc5 APN 18 37821755 missense probably damaging 1.00
IGL02588:Pcdhgc5 APN 18 37821950 missense probably damaging 1.00
IGL03008:Pcdhgc5 APN 18 37821834 missense probably benign
IGL03123:Pcdhgc5 APN 18 37819913 missense probably benign
IGL03235:Pcdhgc5 APN 18 37820098 missense probably damaging 1.00
PIT4495001:Pcdhgc5 UTSW 18 37820977 missense possibly damaging 0.49
R0265:Pcdhgc5 UTSW 18 37821350 missense probably damaging 1.00
R0630:Pcdhgc5 UTSW 18 37821878 missense probably benign 0.04
R1765:Pcdhgc5 UTSW 18 37821860 missense probably benign
R1867:Pcdhgc5 UTSW 18 37821418 missense possibly damaging 0.82
R1939:Pcdhgc5 UTSW 18 37821950 missense probably damaging 1.00
R2136:Pcdhgc5 UTSW 18 37820113 missense possibly damaging 0.95
R3104:Pcdhgc5 UTSW 18 37821674 missense possibly damaging 0.63
R3606:Pcdhgc5 UTSW 18 37820507 missense probably benign 0.00
R4765:Pcdhgc5 UTSW 18 37822069 missense probably benign 0.21
R5789:Pcdhgc5 UTSW 18 37821506 missense probably damaging 0.99
R5864:Pcdhgc5 UTSW 18 37821761 missense probably damaging 1.00
R5995:Pcdhgc5 UTSW 18 37821060 nonsense probably null
R6252:Pcdhgc5 UTSW 18 37821530 missense probably damaging 1.00
R6455:Pcdhgc5 UTSW 18 37821248 missense probably damaging 1.00
R6569:Pcdhgc5 UTSW 18 37820195 missense probably damaging 1.00
R6953:Pcdhgc5 UTSW 18 37820461 missense possibly damaging 0.78
X0022:Pcdhgc5 UTSW 18 37821154 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTCCTCGGTTCTACGTGTG -3'
(R):5'- TCGGTCCCGCACATTAAAC -3'

Sequencing Primer
(F):5'- GTTCTACGTGTGGGACTCCC -3'
(R):5'- GGTCCCGCACATTAAACAACCC -3'
Posted On2018-03-15