Incidental Mutation 'R6286:Fhad1'
ID508225
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6286 (G1)
Quality Score150.008
Status Validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141920898 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 219 (E219V)
Ref Sequence ENSEMBL: ENSMUSP00000036224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036701] [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably damaging
Transcript: ENSMUST00000036701
AA Change: E219V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036224
Gene: ENSMUSG00000051435
AA Change: E219V

DomainStartEndE-ValueType
coiled coil region 31 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105779
AA Change: E884V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: E884V

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105780
AA Change: E884V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: E884V

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137618
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T A 17: 71,880,847 M1300L probably damaging Het
BC080695 T A 4: 143,571,226 V72D probably benign Het
C3 A T 17: 57,224,118 I356N probably damaging Het
Cntnap5b T A 1: 100,255,073 S276T possibly damaging Het
Cts7 C T 13: 61,352,770 G321E probably damaging Het
Cyp11a1 G A 9: 58,017,418 probably benign Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dnttip2 A G 3: 122,284,400 T694A probably damaging Het
Eif3b G T 5: 140,419,811 D151Y probably damaging Het
Gdf2 C T 14: 33,945,100 R260C probably damaging Het
Gm14295 T C 2: 176,809,568 Y284H possibly damaging Het
Gm45861 A G 8: 27,529,591 T745A unknown Het
Grin2a G A 16: 9,761,775 T208I possibly damaging Het
Ide T A 19: 37,278,010 Y798F unknown Het
Llgl1 G A 11: 60,709,532 G569D probably damaging Het
Mrpl9 G C 3: 94,443,790 E92D probably benign Het
Muc16 T A 9: 18,644,389 H3536L unknown Het
Nasp T C 4: 116,604,788 Y526C probably damaging Het
Nfx1 A G 4: 40,986,728 N404D probably damaging Het
Nsrp1 A G 11: 77,049,443 I112T probably damaging Het
Olfr145 A T 9: 37,897,778 I125F probably damaging Het
Olfr789 T C 10: 129,487,628 L206P probably damaging Het
Oxsr1 A G 9: 119,264,882 V235A probably damaging Het
Pamr1 C T 2: 102,640,948 Q539* probably null Het
Ptpn4 A G 1: 119,721,862 probably null Het
Ranbp2 C T 10: 58,479,572 A2038V probably benign Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Homo
Sept5 A G 16: 18,623,377 V253A probably damaging Het
Slc22a13 C A 9: 119,208,712 E117* probably null Het
Slc9c1 T C 16: 45,577,831 I653T probably benign Het
Slco6c1 T A 1: 97,125,720 H152L possibly damaging Het
Sp2 A C 11: 96,961,546 V184G probably benign Het
Taok1 T A 11: 77,553,773 H492L probably benign Het
Tas2r110 G A 6: 132,868,527 D174N probably benign Het
Trim24 G A 6: 37,919,491 probably null Het
Ttc37 T C 13: 76,143,240 L993P probably damaging Het
Ttn G A 2: 76,750,977 R21445* probably null Het
Ttn A G 2: 76,775,623 Y16502H probably damaging Het
Vmn2r84 A C 10: 130,390,868 M367R possibly damaging Het
Zfp46 T C 4: 136,291,009 S385P probably damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGGAGTTTCTTCTGCAGCC -3'
(R):5'- ACACACAGCTCCCATTCATTAATTT -3'

Sequencing Primer
(F):5'- CCCAGCCCTACCTGTATCGTTG -3'
(R):5'- CTATCAAACATCTGGGTCTCGGTG -3'
Posted On2018-03-15