Incidental Mutation 'R6290:Arfgef1'
ID508329
Institutional Source Beutler Lab
Gene Symbol Arfgef1
Ensembl Gene ENSMUSG00000067851
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
SynonymsP200, ARFGEP1, BIG1, D130059B05Rik, D730028O18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001102430.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6290 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location10137571-10232670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10188811 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 687 (E687G)
Ref Sequence ENSEMBL: ENSMUSP00000118805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088615] [ENSMUST00000131556]
Predicted Effect probably benign
Transcript: ENSMUST00000088615
AA Change: E687G

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851
AA Change: E687G

DomainStartEndE-ValueType
Pfam:DCB 28 213 5.2e-45 PFAM
low complexity region 221 233 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 416 575 1.3e-52 PFAM
Blast:Sec7 588 637 6e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 6e-13 BLAST
Blast:Sec7 947 986 8e-18 BLAST
Pfam:DUF1981 1217 1300 3.6e-39 PFAM
low complexity region 1587 1602 N/A INTRINSIC
low complexity region 1777 1782 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131556
AA Change: E687G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118805
Gene: ENSMUSG00000067851
AA Change: E687G

DomainStartEndE-ValueType
coiled coil region 207 234 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 413 576 3.1e-59 PFAM
Blast:Sec7 588 637 2e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 3e-13 BLAST
Blast:Sec7 947 986 2e-18 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Dse A G 10: 34,152,340 M918T probably benign Het
Duox1 C A 2: 122,333,807 T916N possibly damaging Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Paxip1 A T 5: 27,765,578 probably null Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc16a14 T A 1: 84,907,385 I478L probably benign Het
Slc45a1 A T 4: 150,642,639 N174K probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trim67 C T 8: 124,823,179 T516I probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
U2af2 G T 7: 5,075,684 V421L probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in Arfgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arfgef1 APN 1 10199787 missense probably benign
IGL00919:Arfgef1 APN 1 10173237 missense probably damaging 1.00
IGL01022:Arfgef1 APN 1 10174076 missense probably damaging 1.00
IGL01155:Arfgef1 APN 1 10198982 splice site probably benign
IGL01288:Arfgef1 APN 1 10213211 missense possibly damaging 0.67
IGL01397:Arfgef1 APN 1 10159571 missense probably benign 0.40
IGL01433:Arfgef1 APN 1 10153432 missense probably damaging 1.00
IGL01653:Arfgef1 APN 1 10159908 nonsense probably null
IGL01669:Arfgef1 APN 1 10159615 missense probably damaging 1.00
IGL01795:Arfgef1 APN 1 10147528 missense probably benign 0.01
IGL01860:Arfgef1 APN 1 10154396 missense probably damaging 1.00
IGL02137:Arfgef1 APN 1 10213113 missense probably damaging 1.00
IGL02365:Arfgef1 APN 1 10199883 missense probably benign 0.00
IGL02519:Arfgef1 APN 1 10209668 missense probably benign 0.13
IGL02542:Arfgef1 APN 1 10172842 missense probably benign 0.24
IGL02604:Arfgef1 APN 1 10181050 splice site probably benign
IGL02743:Arfgef1 APN 1 10199829 missense probably benign 0.00
IGL03225:Arfgef1 APN 1 10154318 missense probably damaging 1.00
collected UTSW 1 10180938 missense probably damaging 1.00
uncle_joe UTSW 1 10160835 missense probably damaging 1.00
I2288:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
I2289:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
R0383:Arfgef1 UTSW 1 10198842 critical splice donor site probably null
R0491:Arfgef1 UTSW 1 10179987 splice site probably benign
R0636:Arfgef1 UTSW 1 10199851 missense probably benign
R1006:Arfgef1 UTSW 1 10140481 missense probably benign 0.00
R1212:Arfgef1 UTSW 1 10216559 missense probably benign 0.05
R1233:Arfgef1 UTSW 1 10184090 missense probably damaging 1.00
R1346:Arfgef1 UTSW 1 10159733 missense probably benign 0.41
R1416:Arfgef1 UTSW 1 10172939 missense probably damaging 1.00
R1477:Arfgef1 UTSW 1 10189284 missense probably damaging 1.00
R1581:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1587:Arfgef1 UTSW 1 10159959 missense probably damaging 0.99
R1602:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1745:Arfgef1 UTSW 1 10173255 missense probably damaging 1.00
R1831:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1832:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1833:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1918:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1919:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2059:Arfgef1 UTSW 1 10188752 splice site probably null
R2146:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2148:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2149:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2150:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2373:Arfgef1 UTSW 1 10174142 missense probably damaging 1.00
R2516:Arfgef1 UTSW 1 10153654 missense possibly damaging 0.89
R3863:Arfgef1 UTSW 1 10142586 frame shift probably null
R3916:Arfgef1 UTSW 1 10189443 missense probably benign 0.01
R3948:Arfgef1 UTSW 1 10142586 frame shift probably null
R3949:Arfgef1 UTSW 1 10142586 frame shift probably null
R3977:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3978:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3979:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R4086:Arfgef1 UTSW 1 10163759 missense probably benign 0.06
R4175:Arfgef1 UTSW 1 10159636 missense probably damaging 1.00
R4257:Arfgef1 UTSW 1 10159546 intron probably benign
R4572:Arfgef1 UTSW 1 10213141 missense probably damaging 1.00
R4652:Arfgef1 UTSW 1 10173262 missense probably damaging 0.98
R4678:Arfgef1 UTSW 1 10142666 missense probably benign 0.03
R4737:Arfgef1 UTSW 1 10189611 missense possibly damaging 0.85
R4779:Arfgef1 UTSW 1 10153733 missense probably damaging 1.00
R4818:Arfgef1 UTSW 1 10216547 missense probably benign
R4898:Arfgef1 UTSW 1 10159573 missense possibly damaging 0.75
R4979:Arfgef1 UTSW 1 10213109 missense probably damaging 1.00
R5039:Arfgef1 UTSW 1 10199736 missense probably benign 0.37
R5194:Arfgef1 UTSW 1 10204907 missense probably benign 0.09
R5428:Arfgef1 UTSW 1 10160835 missense probably damaging 1.00
R5533:Arfgef1 UTSW 1 10199727 critical splice donor site probably null
R5547:Arfgef1 UTSW 1 10160976 missense probably damaging 1.00
R5562:Arfgef1 UTSW 1 10144746 missense probably damaging 1.00
R5635:Arfgef1 UTSW 1 10188860 missense possibly damaging 0.81
R5697:Arfgef1 UTSW 1 10160838 missense probably benign 0.03
R5704:Arfgef1 UTSW 1 10159583 missense probably damaging 0.98
R5722:Arfgef1 UTSW 1 10138884 missense probably benign 0.04
R5793:Arfgef1 UTSW 1 10209528 missense probably benign 0.01
R5835:Arfgef1 UTSW 1 10160739 missense probably damaging 1.00
R5870:Arfgef1 UTSW 1 10180938 missense probably damaging 1.00
R5990:Arfgef1 UTSW 1 10172921 missense probably damaging 0.99
R6460:Arfgef1 UTSW 1 10213060 missense probably damaging 1.00
R6613:Arfgef1 UTSW 1 10194396 missense possibly damaging 0.95
R6802:Arfgef1 UTSW 1 10189452 missense probably benign 0.35
R6967:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6967:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6968:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6968:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6969:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6969:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6970:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6970:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R7092:Arfgef1 UTSW 1 10153676 missense probably damaging 1.00
R7251:Arfgef1 UTSW 1 10198975 missense possibly damaging 0.81
R7334:Arfgef1 UTSW 1 10184460 missense probably damaging 1.00
R7399:Arfgef1 UTSW 1 10180897 missense probably benign 0.00
V1662:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGAACTAAATATGGAGCCATTC -3'
(R):5'- TCAGTATGTGAACCCCAACTCTC -3'

Sequencing Primer
(F):5'- GGAGCCATTCAATTTTTAGATCCAAG -3'
(R):5'- ACTCTCAAACTACCCTTGGTAAG -3'
Posted On2018-03-15