Incidental Mutation 'R6290:Slc16a14'
ID508331
Institutional Source Beutler Lab
Gene Symbol Slc16a14
Ensembl Gene ENSMUSG00000026220
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms1110004H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6290 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location84905898-84935134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84907385 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 478 (I478L)
Ref Sequence ENSEMBL: ENSMUSP00000027422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027422]
Predicted Effect probably benign
Transcript: ENSMUST00000027422
AA Change: I478L

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027422
Gene: ENSMUSG00000026220
AA Change: I478L

DomainStartEndE-ValueType
Pfam:MFS_1 42 427 6.7e-42 PFAM
Pfam:MFS_1 419 509 7.9e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Arfgef1 T C 1: 10,188,811 E687G possibly damaging Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Dse A G 10: 34,152,340 M918T probably benign Het
Duox1 C A 2: 122,333,807 T916N possibly damaging Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Paxip1 A T 5: 27,765,578 probably null Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc45a1 A T 4: 150,642,639 N174K probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trim67 C T 8: 124,823,179 T516I probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
U2af2 G T 7: 5,075,684 V421L probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in Slc16a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc16a14 APN 1 84922871 missense probably damaging 0.99
IGL01563:Slc16a14 APN 1 84912187 splice site probably benign
R0315:Slc16a14 UTSW 1 84912496 missense possibly damaging 0.46
R0380:Slc16a14 UTSW 1 84929530 missense possibly damaging 0.72
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1837:Slc16a14 UTSW 1 84912399 missense probably benign 0.02
R2149:Slc16a14 UTSW 1 84907399 missense probably damaging 1.00
R2293:Slc16a14 UTSW 1 84912843 missense probably benign
R3790:Slc16a14 UTSW 1 84929280 unclassified probably benign
R4016:Slc16a14 UTSW 1 84912507 nonsense probably null
R4596:Slc16a14 UTSW 1 84929357 missense probably damaging 1.00
R4637:Slc16a14 UTSW 1 84907282 missense possibly damaging 0.86
R4723:Slc16a14 UTSW 1 84913020 missense probably damaging 1.00
R5137:Slc16a14 UTSW 1 84912597 missense probably damaging 1.00
R5262:Slc16a14 UTSW 1 84912891 missense probably benign 0.00
R5410:Slc16a14 UTSW 1 84907424 missense probably damaging 0.98
R5927:Slc16a14 UTSW 1 84912267 missense possibly damaging 0.91
R5968:Slc16a14 UTSW 1 84912505 missense possibly damaging 0.70
R6052:Slc16a14 UTSW 1 84912709 missense possibly damaging 0.75
R6264:Slc16a14 UTSW 1 84907409 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCATCACACAGAGTGTTCCTC -3'
(R):5'- TATCAACTCTGGGTTCCACCG -3'

Sequencing Primer
(F):5'- AGTGTTCCTCTAGGAGCCAG -3'
(R):5'- GTCTTAAACTGTGTTATGCTG -3'
Posted On2018-03-15