Incidental Mutation 'R6290:Duox1'
ID508339
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6290 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122333807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 916 (T916N)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099461
AA Change: T916N

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: T916N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Arfgef1 T C 1: 10,188,811 E687G possibly damaging Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Dse A G 10: 34,152,340 M918T probably benign Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Paxip1 A T 5: 27,765,578 probably null Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc16a14 T A 1: 84,907,385 I478L probably benign Het
Slc45a1 A T 4: 150,642,639 N174K probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trim67 C T 8: 124,823,179 T516I probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
U2af2 G T 7: 5,075,684 V421L probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 intron probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGCTAGTTGGGACCCAG -3'
(R):5'- CTGCTGCAAGCTTAGAGATGC -3'

Sequencing Primer
(F):5'- CAGCTAGTTGGGACCCAGTTATG -3'
(R):5'- TAGCCTACATTGCAAGTTCCAG -3'
Posted On2018-03-15