Incidental Mutation 'R6290:Gm156'
ID508362
Institutional Source Beutler Lab
Gene Symbol Gm156
Ensembl Gene ENSMUSG00000071158
Gene Namepredicted gene 156
SynonymsLOC232415
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6290 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location129766568-129784270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129766695 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 209 (Y209H)
Ref Sequence ENSEMBL: ENSMUSP00000093058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095409] [ENSMUST00000118532]
Predicted Effect probably benign
Transcript: ENSMUST00000095409
AA Change: Y209H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000093058
Gene: ENSMUSG00000071158
AA Change: Y209H

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
transmembrane domain 36 58 N/A INTRINSIC
CLECT 100 215 2.91e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118532
SMART Domains Protein: ENSMUSP00000113766
Gene: ENSMUSG00000071158

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
transmembrane domain 36 58 N/A INTRINSIC
CLECT 100 178 1.85e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Arfgef1 T C 1: 10,188,811 E687G possibly damaging Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Dse A G 10: 34,152,340 M918T probably benign Het
Duox1 C A 2: 122,333,807 T916N possibly damaging Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Paxip1 A T 5: 27,765,578 probably null Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc16a14 T A 1: 84,907,385 I478L probably benign Het
Slc45a1 A T 4: 150,642,639 N174K probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trim67 C T 8: 124,823,179 T516I probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
U2af2 G T 7: 5,075,684 V421L probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in Gm156
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0844:Gm156 UTSW 6 129775793 missense possibly damaging 0.92
R1498:Gm156 UTSW 6 129771740 missense probably damaging 0.98
R1581:Gm156 UTSW 6 129775833 missense probably benign 0.01
R1866:Gm156 UTSW 6 129775380 critical splice donor site probably null
R1967:Gm156 UTSW 6 129775835 missense possibly damaging 0.83
R2289:Gm156 UTSW 6 129768177 missense probably null 0.04
R2384:Gm156 UTSW 6 129772380 missense probably benign
R5192:Gm156 UTSW 6 129771758 missense probably benign 0.15
R5199:Gm156 UTSW 6 129775818 missense possibly damaging 0.68
R6124:Gm156 UTSW 6 129768135 missense probably benign 0.05
R7084:Gm156 UTSW 6 129766710 missense possibly damaging 0.51
X0026:Gm156 UTSW 6 129768162 missense probably damaging 1.00
Z1088:Gm156 UTSW 6 129772463 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACTTGCTTCAGGAGAATAAGGC -3'
(R):5'- CAGAGAGTTGTAGTGTCCACTG -3'

Sequencing Primer
(F):5'- AGGAGAATAAGGCTTCATAAATCATG -3'
(R):5'- GAGTTGTAGTGTCCACTGAAATAAAC -3'
Posted On2018-03-15