Incidental Mutation 'R6290:U2af2'
ID508363
Institutional Source Beutler Lab
Gene Symbol U2af2
Ensembl Gene ENSMUSG00000030435
Gene NameU2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6290 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location5062143-5079938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5075684 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 421 (V421L)
Ref Sequence ENSEMBL: ENSMUSP00000147013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005041] [ENSMUST00000045277] [ENSMUST00000098845] [ENSMUST00000146317] [ENSMUST00000153169] [ENSMUST00000165399] [ENSMUST00000209099]
Predicted Effect probably benign
Transcript: ENSMUST00000005041
AA Change: V417L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005041
Gene: ENSMUSG00000030435
AA Change: V417L

DomainStartEndE-ValueType
low complexity region 23 62 N/A INTRINSIC
PDB:1JMT|B 85 112 9e-13 PDB
RRM 150 227 1.26e-11 SMART
low complexity region 242 257 N/A INTRINSIC
RRM 260 333 8.64e-19 SMART
RRM 377 462 3.04e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045277
SMART Domains Protein: ENSMUSP00000043340
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098845
SMART Domains Protein: ENSMUSP00000096445
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146317
SMART Domains Protein: ENSMUSP00000116571
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
Pfam:ENTH 17 90 7.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153169
SMART Domains Protein: ENSMUSP00000122594
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
Pfam:ENTH 17 54 3.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165399
AA Change: V253L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131458
Gene: ENSMUSG00000030435
AA Change: V253L

DomainStartEndE-ValueType
RRM 8 63 3.31e0 SMART
low complexity region 78 93 N/A INTRINSIC
RRM 96 169 8.64e-19 SMART
RRM 209 294 3.04e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207926
Predicted Effect probably benign
Transcript: ENSMUST00000209099
AA Change: V421L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] U2 auxiliary factor (U2AF), comprised of a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the U2AF large subunit which contains a sequence-specific RNA-binding region with 3 RNA recognition motifs and an Arg/Ser-rich domain necessary for splicing. The large subunit binds to the polypyrimidine tract of introns early during spliceosome assembly. Multiple transcript variants have been detected for this gene, but the full-length natures of only two have been determined to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Arfgef1 T C 1: 10,188,811 E687G possibly damaging Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Dse A G 10: 34,152,340 M918T probably benign Het
Duox1 C A 2: 122,333,807 T916N possibly damaging Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Paxip1 A T 5: 27,765,578 probably null Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc16a14 T A 1: 84,907,385 I478L probably benign Het
Slc45a1 A T 4: 150,642,639 N174K probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trim67 C T 8: 124,823,179 T516I probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in U2af2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:U2af2 APN 7 5067264 splice site probably benign
IGL02980:U2af2 UTSW 7 5068043 missense probably benign 0.37
R0919:U2af2 UTSW 7 5069434 splice site probably benign
R1768:U2af2 UTSW 7 5067545 missense probably benign 0.00
R2228:U2af2 UTSW 7 5075673 missense probably damaging 1.00
R2697:U2af2 UTSW 7 5067546 missense probably benign 0.00
R3974:U2af2 UTSW 7 5069439 splice site probably null
R5777:U2af2 UTSW 7 5066451 missense probably benign 0.37
R5916:U2af2 UTSW 7 5079180 critical splice acceptor site probably null
R6860:U2af2 UTSW 7 5079274 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GTGACAGATCTGTTCTCCCTGAC -3'
(R):5'- TTTCTCCACTATAGGCCCCAAG -3'

Sequencing Primer
(F):5'- GACACCTGTGACCCTTCAAGTG -3'
(R):5'- GACCCCAGGAGACCTTGATC -3'
Posted On2018-03-15