Incidental Mutation 'R6290:Slc5a5'
ID508371
Institutional Source Beutler Lab
Gene Symbol Slc5a5
Ensembl Gene ENSMUSG00000000792
Gene Namesolute carrier family 5 (sodium iodide symporter), member 5
SynonymsNIS
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6290 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70882889-70892757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70891178 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 160 (T160I)
Ref Sequence ENSEMBL: ENSMUSP00000000809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000809] [ENSMUST00000054220] [ENSMUST00000212129] [ENSMUST00000212378] [ENSMUST00000212494] [ENSMUST00000212709] [ENSMUST00000212796] [ENSMUST00000213053]
Predicted Effect probably damaging
Transcript: ENSMUST00000000809
AA Change: T160I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: T160I

DomainStartEndE-ValueType
Pfam:SSF 47 452 2.5e-43 PFAM
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054220
SMART Domains Protein: ENSMUSP00000058368
Gene: ENSMUSG00000045128

DomainStartEndE-ValueType
Pfam:Ribosomal_L18ae 7 130 1.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212019
Predicted Effect probably benign
Transcript: ENSMUST00000212129
Predicted Effect probably benign
Transcript: ENSMUST00000212378
Predicted Effect probably benign
Transcript: ENSMUST00000212494
Predicted Effect probably benign
Transcript: ENSMUST00000212709
Predicted Effect probably benign
Transcript: ENSMUST00000212796
Predicted Effect probably benign
Transcript: ENSMUST00000213053
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Arfgef1 T C 1: 10,188,811 E687G possibly damaging Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Dse A G 10: 34,152,340 M918T probably benign Het
Duox1 C A 2: 122,333,807 T916N possibly damaging Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Paxip1 A T 5: 27,765,578 probably null Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc16a14 T A 1: 84,907,385 I478L probably benign Het
Slc45a1 A T 4: 150,642,639 N174K probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trim67 C T 8: 124,823,179 T516I probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
U2af2 G T 7: 5,075,684 V421L probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in Slc5a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Slc5a5 APN 8 70888537 missense probably damaging 0.99
IGL01372:Slc5a5 APN 8 70890376 unclassified probably benign
IGL01394:Slc5a5 APN 8 70889388 nonsense probably null
IGL01571:Slc5a5 APN 8 70891332 unclassified probably benign
IGL02043:Slc5a5 APN 8 70892429 missense possibly damaging 0.84
IGL02186:Slc5a5 APN 8 70886120 missense possibly damaging 0.79
IGL02479:Slc5a5 APN 8 70888911 missense possibly damaging 0.67
IGL02559:Slc5a5 APN 8 70890271 missense probably damaging 1.00
IGL02892:Slc5a5 APN 8 70892517 missense probably damaging 1.00
IGL03388:Slc5a5 APN 8 70890328 missense probably benign 0.45
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0413:Slc5a5 UTSW 8 70891675 missense possibly damaging 0.63
R0662:Slc5a5 UTSW 8 70883875 missense probably benign 0.01
R0781:Slc5a5 UTSW 8 70890220 missense probably benign 0.19
R1061:Slc5a5 UTSW 8 70890221 missense probably benign 0.00
R1400:Slc5a5 UTSW 8 70889435 missense possibly damaging 0.87
R1524:Slc5a5 UTSW 8 70892334 missense probably damaging 1.00
R2033:Slc5a5 UTSW 8 70888587 missense probably damaging 0.99
R2072:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2075:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2110:Slc5a5 UTSW 8 70889751 intron probably null
R2111:Slc5a5 UTSW 8 70889751 intron probably null
R2112:Slc5a5 UTSW 8 70889751 intron probably null
R2201:Slc5a5 UTSW 8 70892458 missense probably damaging 0.98
R3978:Slc5a5 UTSW 8 70889395 missense probably benign 0.00
R4244:Slc5a5 UTSW 8 70890286 missense probably benign
R5161:Slc5a5 UTSW 8 70888848 missense probably damaging 1.00
R5397:Slc5a5 UTSW 8 70891179 missense probably damaging 1.00
R5718:Slc5a5 UTSW 8 70887755 missense probably benign 0.00
R5740:Slc5a5 UTSW 8 70888917 splice site probably null
R5869:Slc5a5 UTSW 8 70892330 missense probably damaging 1.00
R6268:Slc5a5 UTSW 8 70888620 missense probably damaging 1.00
R6292:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTATGTAGGAGAGGACACGG -3'
(R):5'- ACACCTTCTTGCAACCTGGC -3'

Sequencing Primer
(F):5'- ACACGGGCACAGTTAGGC -3'
(R):5'- TTGCAACCTGGCTCCGC -3'
Posted On2018-03-15