Incidental Mutation 'R6290:Dse'
ID508375
Institutional Source Beutler Lab
Gene Symbol Dse
Ensembl Gene ENSMUSG00000039497
Gene Namedermatan sulfate epimerase
SynonymsSart2, DS-epi1, B130024B19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R6290 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location34151393-34207715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34152340 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 918 (M918T)
Ref Sequence ENSEMBL: ENSMUSP00000040074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048010] [ENSMUST00000217051]
Predicted Effect probably benign
Transcript: ENSMUST00000048010
AA Change: M918T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040074
Gene: ENSMUSG00000039497
AA Change: M918T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4962 24 353 5.2e-11 PFAM
low complexity region 558 568 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 935 952 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216774
Predicted Effect probably benign
Transcript: ENSMUST00000217051
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor-rejection antigen. It is localized to the endoplasmic reticulum and functions to convert D-glucuronic acid to L-iduronic acid during the biosynthesis of dermatan sulfate. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. Mutations in this gene cause inmusculocontractural Ehlers-Danlos syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 9, and a paralogous gene exists on chromosome 18. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length with altered skin morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,593,005 probably null Het
Aim2 T A 1: 173,462,115 I208N possibly damaging Het
Ank3 A C 10: 69,991,368 probably benign Het
Arfgef1 T C 1: 10,188,811 E687G possibly damaging Het
Ash1l T A 3: 88,982,761 L649* probably null Het
Atp7b C T 8: 22,020,820 G437S probably damaging Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Cep89 G A 7: 35,420,263 G349D probably damaging Het
Cntn6 T A 6: 104,767,890 Y315N probably damaging Het
Csrp2 T C 10: 110,931,983 C10R probably damaging Het
Cux1 T C 5: 136,311,558 N625D probably damaging Het
Dnah9 T C 11: 65,841,375 N4235S probably damaging Het
Dpy19l1 A G 9: 24,462,600 C265R probably damaging Het
Duox1 C A 2: 122,333,807 T916N possibly damaging Het
E130308A19Rik A T 4: 59,691,332 I389F probably benign Het
Eif2ak1 T A 5: 143,884,799 V311D probably benign Het
Eps15 T A 4: 109,363,198 M534K probably benign Het
Gm156 A G 6: 129,766,695 Y209H probably benign Het
Gpr182 A T 10: 127,751,024 F19L probably benign Het
Ifi214 T A 1: 173,529,417 D40V probably damaging Het
Klhl2 A G 8: 64,811,699 V121A possibly damaging Het
Mylk T A 16: 34,894,843 S514T probably benign Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naga T G 15: 82,334,856 D230A possibly damaging Het
Napsa A G 7: 44,581,337 N70D probably benign Het
Nup210l T A 3: 90,119,909 Y199* probably null Het
Olfml2b A T 1: 170,649,790 K165* probably null Het
Olfr352 C T 2: 36,870,436 P290L probably damaging Het
Paxip1 A T 5: 27,765,578 probably null Het
Pcyox1 T A 6: 86,388,899 K444N probably benign Het
Pikfyve T A 1: 65,202,925 probably null Het
Ppp6r3 T C 19: 3,494,011 I335V probably benign Het
Prkcz A G 4: 155,356,499 S71P probably damaging Het
Psg19 C T 7: 18,794,089 R243Q probably benign Het
Ptbp2 A T 3: 119,724,120 M382K possibly damaging Het
Slc16a14 T A 1: 84,907,385 I478L probably benign Het
Slc45a1 A T 4: 150,642,639 N174K probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smpdl3b T A 4: 132,738,275 H278L possibly damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Synpo2 A T 3: 123,117,052 S315T probably damaging Het
Taok3 A G 5: 117,204,368 Y137C probably damaging Het
Tapbpl T C 6: 125,230,716 D49G probably benign Het
Tbr1 T C 2: 61,805,050 S115P probably benign Het
Trim67 C T 8: 124,823,179 T516I probably benign Het
Trrap T A 5: 144,805,018 L1351Q probably damaging Het
Tsc2 A G 17: 24,596,910 I166T probably benign Het
Tspan8 T A 10: 115,827,824 C22S probably damaging Het
Tyro3 T C 2: 119,816,840 S813P probably benign Het
U2af2 G T 7: 5,075,684 V421L probably benign Het
Vmn1r77 T C 7: 12,041,809 S103P probably damaging Het
Vmn2r1 T A 3: 64,105,452 D911E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r56 A T 7: 12,694,882 C486S probably damaging Het
Vwa8 A G 14: 79,094,332 probably null Het
Xirp1 T G 9: 120,018,725 E364A probably benign Het
Zbp1 T C 2: 173,215,841 E99G probably damaging Het
Zfp385b C A 2: 77,450,268 V109F possibly damaging Het
Other mutations in Dse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dse APN 10 34162805 missense probably damaging 1.00
IGL01828:Dse APN 10 34152776 missense probably damaging 0.97
IGL01835:Dse APN 10 34160217 splice site probably benign
IGL01942:Dse APN 10 34155993 missense probably benign 0.02
IGL02047:Dse APN 10 34162845 nonsense probably null
IGL02208:Dse APN 10 34152437 missense probably benign
IGL02306:Dse APN 10 34160134 missense probably damaging 0.96
IGL02504:Dse APN 10 34152800 missense probably benign
IGL02626:Dse APN 10 34153162 missense probably damaging 0.99
IGL02812:Dse APN 10 34183716 missense probably damaging 1.00
R0018:Dse UTSW 10 34153468 missense probably benign 0.00
R0018:Dse UTSW 10 34153468 missense probably benign 0.00
R0131:Dse UTSW 10 34153664 missense probably damaging 1.00
R1300:Dse UTSW 10 34152415 missense probably benign 0.00
R1502:Dse UTSW 10 34153218 missense probably damaging 1.00
R1619:Dse UTSW 10 34153234 missense probably damaging 1.00
R1736:Dse UTSW 10 34153149 missense probably damaging 1.00
R1857:Dse UTSW 10 34153229 missense probably benign 0.03
R1858:Dse UTSW 10 34153229 missense probably benign 0.03
R1859:Dse UTSW 10 34153229 missense probably benign 0.03
R1868:Dse UTSW 10 34153288 missense possibly damaging 0.86
R1959:Dse UTSW 10 34160206 missense probably damaging 1.00
R2082:Dse UTSW 10 34155940 missense probably damaging 1.00
R2325:Dse UTSW 10 34184047 missense probably benign 0.23
R2883:Dse UTSW 10 34152507 missense probably benign 0.34
R3436:Dse UTSW 10 34152474 missense probably benign
R3818:Dse UTSW 10 34153433 missense probably benign
R4158:Dse UTSW 10 34153334 missense probably damaging 1.00
R4159:Dse UTSW 10 34153334 missense probably damaging 1.00
R4160:Dse UTSW 10 34153334 missense probably damaging 1.00
R4229:Dse UTSW 10 34162744 missense probably damaging 1.00
R4414:Dse UTSW 10 34152636 missense probably benign 0.04
R4667:Dse UTSW 10 34153012 missense probably damaging 1.00
R4669:Dse UTSW 10 34153012 missense probably damaging 1.00
R4777:Dse UTSW 10 34153588 missense possibly damaging 0.56
R5154:Dse UTSW 10 34153661 missense possibly damaging 0.83
R5573:Dse UTSW 10 34152682 missense probably benign 0.02
R5804:Dse UTSW 10 34153379 missense possibly damaging 0.84
R5844:Dse UTSW 10 34153042 missense probably damaging 0.99
R5895:Dse UTSW 10 34152605 missense probably damaging 1.00
R6600:Dse UTSW 10 34152541 missense probably benign 0.06
R7088:Dse UTSW 10 34153889 missense probably damaging 1.00
R7254:Dse UTSW 10 34184148 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAAGTAAATCTGGACGAGAC -3'
(R):5'- GCTCAGAGAGAACAGCCCATAG -3'

Sequencing Primer
(F):5'- AATACATGCATACATTTCCTGACCTC -3'
(R):5'- ATGAAAGACCTTTTGGATTTTGCTG -3'
Posted On2018-03-15