Incidental Mutation 'R6291:Zc3h14'
ID508454
Institutional Source Beutler Lab
Gene Symbol Zc3h14
Ensembl Gene ENSMUSG00000021012
Gene Namezinc finger CCCH type containing 14
Synonyms1700016A15Rik, 1010001P15Rik, 2700069A02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6291 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location98746964-98787753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98759828 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 324 (R324H)
Ref Sequence ENSEMBL: ENSMUSP00000105732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532] [ENSMUST00000223083]
Predicted Effect probably damaging
Transcript: ENSMUST00000057000
AA Change: R324H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012
AA Change: R324H

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110104
AA Change: R324H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012
AA Change: R324H

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110105
AA Change: R324H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012
AA Change: R324H

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222913
Predicted Effect probably benign
Transcript: ENSMUST00000223083
Predicted Effect probably benign
Transcript: ENSMUST00000223451
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,566,544 G5D possibly damaging Het
Adamts9 T C 6: 92,890,120 K95R probably damaging Het
Adap1 G T 5: 139,273,491 L314M probably benign Het
Alkbh1 T A 12: 87,429,094 E306V possibly damaging Het
Alpk2 T A 18: 65,305,901 D1274V possibly damaging Het
Ankrd31 A C 13: 96,878,238 K1188N possibly damaging Het
Aox2 T A 1: 58,330,806 M759K probably damaging Het
Atp13a3 T A 16: 30,336,243 D961V probably damaging Het
BC067074 T A 13: 113,320,447 I1009N possibly damaging Het
Bcl11a G A 11: 24,158,321 G100R probably damaging Het
Bpifc G A 10: 85,976,258 A362V probably damaging Het
Btaf1 C T 19: 36,973,008 T546I probably benign Het
Casd1 C A 6: 4,619,834 P193Q probably damaging Het
Cdhr1 T C 14: 37,089,465 T230A probably benign Het
Celsr3 T G 9: 108,828,842 D841E probably damaging Het
Cenpj T C 14: 56,551,976 D872G probably benign Het
Cep95 G T 11: 106,815,596 A559S probably damaging Het
Chpt1 A T 10: 88,475,444 C62* probably null Het
Cspp1 A G 1: 10,064,334 K103R probably damaging Het
Ctla4 T C 1: 60,912,678 V122A probably benign Het
Cyp3a11 A G 5: 145,862,427 F317L possibly damaging Het
Daam1 T C 12: 71,946,251 L338P unknown Het
Dcc T A 18: 71,682,167 I379L probably benign Het
Dennd2c C A 3: 103,131,609 C24* probably null Het
Dnajc12 A G 10: 63,397,274 I65V probably benign Het
Dock3 T A 9: 106,908,432 M208L probably benign Het
Dsg1b T C 18: 20,404,791 I588T possibly damaging Het
Eif1b T C 9: 120,494,140 L22S probably benign Het
Ep300 T A 15: 81,648,507 S1649T unknown Het
Eps15 CAAA CAA 4: 109,305,703 probably null Het
Ercc6 A T 14: 32,569,986 E1102D probably benign Het
Gsdmc3 T C 15: 63,860,241 N312S probably benign Het
Guca2b A T 4: 119,657,693 L57Q probably damaging Het
Heatr5b G T 17: 78,762,097 H1740Q probably benign Het
Hecw1 G A 13: 14,523,007 probably benign Het
Icam5 A G 9: 21,036,921 H675R probably benign Het
Il18rap T C 1: 40,524,889 F56L probably benign Het
Iqgap3 T A 3: 88,089,730 probably null Het
Itsn1 T C 16: 91,868,096 probably benign Het
Jakmip3 A T 7: 139,020,856 D315V probably damaging Het
Kif24 A G 4: 41,413,959 Y328H probably damaging Het
Kmt2a A T 9: 44,832,874 probably benign Het
Kng1 A G 16: 23,079,725 E625G probably damaging Het
Man2b1 C T 8: 85,097,046 T973I probably benign Het
Masp2 G A 4: 148,602,753 V31M probably damaging Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naa15 G A 3: 51,442,791 G103D probably damaging Het
Olfr1029 A G 2: 85,975,582 Y113C probably damaging Het
Olfr1309 A G 2: 111,983,624 V150A probably benign Het
Olfr873 T A 9: 20,300,603 D134E probably damaging Het
Papln A G 12: 83,783,015 N970S probably benign Het
Pick1 T A 15: 79,251,728 probably null Het
Pigr A C 1: 130,841,761 D103A probably benign Het
Plekhf1 A C 7: 38,221,605 F180V possibly damaging Het
Plxnc1 A G 10: 94,833,642 probably null Het
Polr3f A G 2: 144,534,388 I136V probably damaging Het
Ppp2r2c T C 5: 36,940,124 M218T possibly damaging Het
Prox2 C T 12: 85,089,646 V466I probably damaging Het
Prrc2a G A 17: 35,154,933 L1479F probably damaging Het
Rbm24 T A 13: 46,421,837 probably null Het
Rcc1l A T 5: 134,166,721 probably null Het
Ripk4 A C 16: 97,755,123 L140R probably damaging Het
Rmnd1 A T 10: 4,422,135 L188Q probably damaging Het
Rnf170 C T 8: 26,140,964 P249S probably damaging Het
Rras A G 7: 45,018,171 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn7a T A 2: 66,700,114 D629V probably damaging Het
Sipa1l3 A G 7: 29,388,133 S556P probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Snca C T 6: 60,815,718 A69T probably damaging Het
Snx2 T C 18: 53,209,665 probably null Het
Spp1 T A 5: 104,439,376 S109T possibly damaging Het
Stoml3 T C 3: 53,507,516 L243P probably damaging Het
Susd2 A G 10: 75,637,574 F789L possibly damaging Het
Sycp1 A G 3: 102,908,961 M419T probably damaging Het
Thoc1 T C 18: 9,993,330 V563A probably benign Het
Tmprss11g T C 5: 86,487,422 I398V probably damaging Het
Tox3 A G 8: 90,248,938 L355P probably damaging Het
Tpp1 A G 7: 105,747,016 I492T probably benign Het
Trim21 A T 7: 102,564,082 L3Q probably damaging Het
Ttn A C 2: 76,907,736 V4153G probably benign Het
Ttn T C 2: 76,914,294 probably benign Het
Unc80 A G 1: 66,521,597 E828G possibly damaging Het
Vav3 A G 3: 109,508,854 N263S possibly damaging Het
Vmn1r183 A C 7: 24,055,557 T262P possibly damaging Het
Vmn2r67 G A 7: 85,149,934 P522S possibly damaging Het
Vps35 T A 8: 85,299,457 M1L probably benign Het
Wdr63 G A 3: 146,066,893 S466L probably benign Het
Xpo7 A T 14: 70,704,690 L79* probably null Het
Zfp330 T C 8: 82,772,984 T6A probably damaging Het
Zfp948 T A 17: 21,587,024 H159Q unknown Het
Other mutations in Zc3h14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Zc3h14 APN 12 98747524 critical splice donor site probably null
IGL00946:Zc3h14 APN 12 98759883 splice site probably benign
IGL00969:Zc3h14 APN 12 98758843 missense probably benign 0.00
IGL01626:Zc3h14 APN 12 98779186 missense possibly damaging 0.72
IGL01891:Zc3h14 APN 12 98758947 unclassified probably benign
IGL02119:Zc3h14 APN 12 98763895 missense probably benign 0.00
IGL02484:Zc3h14 APN 12 98774301 missense probably benign 0.14
IGL02744:Zc3h14 APN 12 98784975 missense possibly damaging 0.67
IGL02894:Zc3h14 APN 12 98758943 critical splice donor site probably null
R0408:Zc3h14 UTSW 12 98763823 missense probably damaging 1.00
R0739:Zc3h14 UTSW 12 98757201 missense probably damaging 0.99
R0865:Zc3h14 UTSW 12 98779269 critical splice donor site probably null
R0926:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R1530:Zc3h14 UTSW 12 98785003 missense probably damaging 1.00
R1735:Zc3h14 UTSW 12 98758580 missense probably damaging 1.00
R1743:Zc3h14 UTSW 12 98779189 missense probably benign 0.04
R1848:Zc3h14 UTSW 12 98752832 missense possibly damaging 0.89
R1851:Zc3h14 UTSW 12 98760354 nonsense probably null
R1978:Zc3h14 UTSW 12 98763922 missense probably damaging 0.97
R2011:Zc3h14 UTSW 12 98780268 missense possibly damaging 0.76
R2198:Zc3h14 UTSW 12 98752809 missense probably damaging 1.00
R2198:Zc3h14 UTSW 12 98752810 missense possibly damaging 0.94
R2263:Zc3h14 UTSW 12 98758514 missense probably benign 0.32
R3762:Zc3h14 UTSW 12 98758643 missense probably damaging 1.00
R4210:Zc3h14 UTSW 12 98785399 missense probably damaging 1.00
R4353:Zc3h14 UTSW 12 98763960 missense possibly damaging 0.70
R4360:Zc3h14 UTSW 12 98780197 missense probably benign 0.09
R4814:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4815:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4817:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4947:Zc3h14 UTSW 12 98759824 missense probably benign
R5077:Zc3h14 UTSW 12 98757206 critical splice donor site probably null
R5431:Zc3h14 UTSW 12 98780065 missense possibly damaging 0.94
R5783:Zc3h14 UTSW 12 98757175 missense probably damaging 0.99
R5850:Zc3h14 UTSW 12 98779155 missense probably damaging 0.97
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6338:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R6595:Zc3h14 UTSW 12 98757026 missense probably damaging 0.98
R6737:Zc3h14 UTSW 12 98785046 missense probably damaging 1.00
R6932:Zc3h14 UTSW 12 98771077 intron probably benign
R7074:Zc3h14 UTSW 12 98758600 missense possibly damaging 0.96
R7204:Zc3h14 UTSW 12 98771356 missense probably damaging 1.00
R7237:Zc3h14 UTSW 12 98780149 missense probably benign 0.34
R7267:Zc3h14 UTSW 12 98785729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGTTCTGGCCCAAAAG -3'
(R):5'- CACTTATCTACCATGAGCATGCAC -3'

Sequencing Primer
(F):5'- AGGGCATTGGATCCCATTAC -3'
(R):5'- TGAGCATGCACAGCCCC -3'
Posted On2018-03-15