Incidental Mutation 'R6291:Heatr5b'
ID508471
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R6291 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78762097 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1740 (H1740Q)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably benign
Transcript: ENSMUST00000097281
AA Change: H1740Q

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: H1740Q

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,566,544 G5D possibly damaging Het
Adamts9 T C 6: 92,890,120 K95R probably damaging Het
Adap1 G T 5: 139,273,491 L314M probably benign Het
Alkbh1 T A 12: 87,429,094 E306V possibly damaging Het
Alpk2 T A 18: 65,305,901 D1274V possibly damaging Het
Ankrd31 A C 13: 96,878,238 K1188N possibly damaging Het
Aox2 T A 1: 58,330,806 M759K probably damaging Het
Atp13a3 T A 16: 30,336,243 D961V probably damaging Het
BC067074 T A 13: 113,320,447 I1009N possibly damaging Het
Bcl11a G A 11: 24,158,321 G100R probably damaging Het
Bpifc G A 10: 85,976,258 A362V probably damaging Het
Btaf1 C T 19: 36,973,008 T546I probably benign Het
Casd1 C A 6: 4,619,834 P193Q probably damaging Het
Cdhr1 T C 14: 37,089,465 T230A probably benign Het
Celsr3 T G 9: 108,828,842 D841E probably damaging Het
Cenpj T C 14: 56,551,976 D872G probably benign Het
Cep95 G T 11: 106,815,596 A559S probably damaging Het
Chpt1 A T 10: 88,475,444 C62* probably null Het
Cspp1 A G 1: 10,064,334 K103R probably damaging Het
Ctla4 T C 1: 60,912,678 V122A probably benign Het
Cyp3a11 A G 5: 145,862,427 F317L possibly damaging Het
Daam1 T C 12: 71,946,251 L338P unknown Het
Dcc T A 18: 71,682,167 I379L probably benign Het
Dennd2c C A 3: 103,131,609 C24* probably null Het
Dnajc12 A G 10: 63,397,274 I65V probably benign Het
Dock3 T A 9: 106,908,432 M208L probably benign Het
Dsg1b T C 18: 20,404,791 I588T possibly damaging Het
Eif1b T C 9: 120,494,140 L22S probably benign Het
Ep300 T A 15: 81,648,507 S1649T unknown Het
Eps15 CAAA CAA 4: 109,305,703 probably null Het
Ercc6 A T 14: 32,569,986 E1102D probably benign Het
Gsdmc3 T C 15: 63,860,241 N312S probably benign Het
Guca2b A T 4: 119,657,693 L57Q probably damaging Het
Hecw1 G A 13: 14,523,007 probably benign Het
Icam5 A G 9: 21,036,921 H675R probably benign Het
Il18rap T C 1: 40,524,889 F56L probably benign Het
Iqgap3 T A 3: 88,089,730 probably null Het
Itsn1 T C 16: 91,868,096 probably benign Het
Jakmip3 A T 7: 139,020,856 D315V probably damaging Het
Kif24 A G 4: 41,413,959 Y328H probably damaging Het
Kmt2a A T 9: 44,832,874 probably benign Het
Kng1 A G 16: 23,079,725 E625G probably damaging Het
Man2b1 C T 8: 85,097,046 T973I probably benign Het
Masp2 G A 4: 148,602,753 V31M probably damaging Het
Myo18b C T 5: 112,865,735 R785H possibly damaging Het
Naa15 G A 3: 51,442,791 G103D probably damaging Het
Olfr1029 A G 2: 85,975,582 Y113C probably damaging Het
Olfr1309 A G 2: 111,983,624 V150A probably benign Het
Olfr873 T A 9: 20,300,603 D134E probably damaging Het
Papln A G 12: 83,783,015 N970S probably benign Het
Pick1 T A 15: 79,251,728 probably null Het
Pigr A C 1: 130,841,761 D103A probably benign Het
Plekhf1 A C 7: 38,221,605 F180V possibly damaging Het
Plxnc1 A G 10: 94,833,642 probably null Het
Polr3f A G 2: 144,534,388 I136V probably damaging Het
Ppp2r2c T C 5: 36,940,124 M218T possibly damaging Het
Prox2 C T 12: 85,089,646 V466I probably damaging Het
Prrc2a G A 17: 35,154,933 L1479F probably damaging Het
Rbm24 T A 13: 46,421,837 probably null Het
Rcc1l A T 5: 134,166,721 probably null Het
Ripk4 A C 16: 97,755,123 L140R probably damaging Het
Rmnd1 A T 10: 4,422,135 L188Q probably damaging Het
Rnf170 C T 8: 26,140,964 P249S probably damaging Het
Rras A G 7: 45,018,171 probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn7a T A 2: 66,700,114 D629V probably damaging Het
Sipa1l3 A G 7: 29,388,133 S556P probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Snca C T 6: 60,815,718 A69T probably damaging Het
Snx2 T C 18: 53,209,665 probably null Het
Spp1 T A 5: 104,439,376 S109T possibly damaging Het
Stoml3 T C 3: 53,507,516 L243P probably damaging Het
Susd2 A G 10: 75,637,574 F789L possibly damaging Het
Sycp1 A G 3: 102,908,961 M419T probably damaging Het
Thoc1 T C 18: 9,993,330 V563A probably benign Het
Tmprss11g T C 5: 86,487,422 I398V probably damaging Het
Tox3 A G 8: 90,248,938 L355P probably damaging Het
Tpp1 A G 7: 105,747,016 I492T probably benign Het
Trim21 A T 7: 102,564,082 L3Q probably damaging Het
Ttn A C 2: 76,907,736 V4153G probably benign Het
Ttn T C 2: 76,914,294 probably benign Het
Unc80 A G 1: 66,521,597 E828G possibly damaging Het
Vav3 A G 3: 109,508,854 N263S possibly damaging Het
Vmn1r183 A C 7: 24,055,557 T262P possibly damaging Het
Vmn2r67 G A 7: 85,149,934 P522S possibly damaging Het
Vps35 T A 8: 85,299,457 M1L probably benign Het
Wdr63 G A 3: 146,066,893 S466L probably benign Het
Xpo7 A T 14: 70,704,690 L79* probably null Het
Zc3h14 G A 12: 98,759,828 R324H probably damaging Het
Zfp330 T C 8: 82,772,984 T6A probably damaging Het
Zfp948 T A 17: 21,587,024 H159Q unknown Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense not run
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGTTAAAATCCAAAGGCCACTC -3'
(R):5'- GCCAGAACACTGTACCAAGG -3'

Sequencing Primer
(F):5'- ATCCAAAGGCCACTCATCTTTATC -3'
(R):5'- GCCTCATTCCTGGAAAGT -3'
Posted On2018-03-15