Incidental Mutation 'R6292:Paqr6'
ID508487
Institutional Source Beutler Lab
Gene Symbol Paqr6
Ensembl Gene ENSMUSG00000041423
Gene Nameprogestin and adipoQ receptor family member VI
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6292 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88364584-88368541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88367898 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 213 (P213S)
Ref Sequence ENSEMBL: ENSMUSP00000119656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075523] [ENSMUST00000107542] [ENSMUST00000107543] [ENSMUST00000147948] [ENSMUST00000147991]
Predicted Effect probably benign
Transcript: ENSMUST00000075523
SMART Domains Protein: ENSMUSP00000074965
Gene: ENSMUSG00000074489

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107542
SMART Domains Protein: ENSMUSP00000103166
Gene: ENSMUSG00000074489

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107543
SMART Domains Protein: ENSMUSP00000103167
Gene: ENSMUSG00000074489

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147818
Predicted Effect probably damaging
Transcript: ENSMUST00000147948
AA Change: P213S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119656
Gene: ENSMUSG00000041423
AA Change: P213S

DomainStartEndE-ValueType
Pfam:HlyIII 59 161 6.8e-18 PFAM
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147991
AA Change: P323S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114166
Gene: ENSMUSG00000041423
AA Change: P323S

DomainStartEndE-ValueType
Pfam:HlyIII 43 271 5.5e-51 PFAM
transmembrane domain 292 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152477
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gdap1l1 A T 2: 163,451,507 I218F probably damaging Het
Gm5141 A T 13: 62,774,438 C306S probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hs3st1 T A 5: 39,614,790 Q170L possibly damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lilra5 T C 7: 4,238,339 S92P possibly damaging Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
Myh7b A T 2: 155,632,396 Q1677L probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr314 T A 11: 58,786,237 M1K probably null Het
Olfr620 T A 7: 103,612,179 H58L probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Rasal1 T A 5: 120,659,620 V139E probably damaging Het
Scgb1b24 G T 7: 33,744,152 A79S possibly damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Paqr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Paqr6 APN 3 88366184 missense probably damaging 1.00
IGL02622:Paqr6 APN 3 88365778 missense probably damaging 1.00
PIT4431001:Paqr6 UTSW 3 88365777 missense possibly damaging 0.87
R0883:Paqr6 UTSW 3 88365991 missense probably damaging 1.00
R2369:Paqr6 UTSW 3 88365953 missense probably damaging 1.00
R4705:Paqr6 UTSW 3 88365929 missense probably benign 0.03
R5103:Paqr6 UTSW 3 88367717 nonsense probably null
R5922:Paqr6 UTSW 3 88366237 missense probably benign 0.00
R6364:Paqr6 UTSW 3 88365958 missense probably damaging 0.98
R7023:Paqr6 UTSW 3 88366046 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGCTGTTCCATATCTGTG -3'
(R):5'- TGTCCCTAGAGAGCCTCTTC -3'

Sequencing Primer
(F):5'- CCATATCTGTGCCGTGCTGG -3'
(R):5'- AGAGAGCCTCTTCTCTTCAGC -3'
Posted On2018-03-15