Incidental Mutation 'R6292:Rasal1'
ID508493
Institutional Source Beutler Lab
Gene Symbol Rasal1
Ensembl Gene ENSMUSG00000029602
Gene NameRAS protein activator like 1 (GAP1 like)
SynonymsMRASAL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6292 (G1)
Quality Score163.009
Status Validated
Chromosome5
Chromosomal Location120648812-120679597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120659620 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 139 (V139E)
Ref Sequence ENSEMBL: ENSMUSP00000123266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000125804] [ENSMUST00000156722]
Predicted Effect probably damaging
Transcript: ENSMUST00000031606
AA Change: V139E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: V139E

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125804
SMART Domains Protein: ENSMUSP00000119913
Gene: ENSMUSG00000029602

DomainStartEndE-ValueType
Pfam:C2 7 73 4.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148695
Predicted Effect probably damaging
Transcript: ENSMUST00000156722
AA Change: V139E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: V139E

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gdap1l1 A T 2: 163,451,507 I218F probably damaging Het
Gm5141 A T 13: 62,774,438 C306S probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hs3st1 T A 5: 39,614,790 Q170L possibly damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lilra5 T C 7: 4,238,339 S92P possibly damaging Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
Myh7b A T 2: 155,632,396 Q1677L probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr314 T A 11: 58,786,237 M1K probably null Het
Olfr620 T A 7: 103,612,179 H58L probably damaging Het
Paqr6 C T 3: 88,367,898 P213S probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Scgb1b24 G T 7: 33,744,152 A79S possibly damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Rasal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Rasal1 APN 5 120664807 missense probably damaging 1.00
IGL01700:Rasal1 APN 5 120676817 missense probably benign 0.06
IGL01790:Rasal1 APN 5 120670318 missense possibly damaging 0.61
IGL01866:Rasal1 APN 5 120675423 missense probably damaging 1.00
IGL02143:Rasal1 APN 5 120652852 missense probably damaging 1.00
IGL02527:Rasal1 APN 5 120666404 missense probably damaging 0.98
IGL02565:Rasal1 APN 5 120676780 splice site probably benign
IGL02710:Rasal1 APN 5 120666431 missense possibly damaging 0.71
PIT4618001:Rasal1 UTSW 5 120670376 missense probably damaging 0.99
R0270:Rasal1 UTSW 5 120674729 missense probably damaging 0.97
R0281:Rasal1 UTSW 5 120674605 missense probably benign
R0673:Rasal1 UTSW 5 120670384 missense probably benign 0.26
R1227:Rasal1 UTSW 5 120670307 missense probably damaging 0.99
R1475:Rasal1 UTSW 5 120662982 missense possibly damaging 0.55
R1486:Rasal1 UTSW 5 120654852 missense probably damaging 1.00
R1557:Rasal1 UTSW 5 120676849 missense possibly damaging 0.87
R1651:Rasal1 UTSW 5 120652845 nonsense probably null
R1792:Rasal1 UTSW 5 120664756 missense probably benign 0.06
R2148:Rasal1 UTSW 5 120662031 missense probably damaging 0.97
R2964:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2966:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2983:Rasal1 UTSW 5 120654862 missense probably benign 0.45
R4090:Rasal1 UTSW 5 120675609 missense possibly damaging 0.95
R4205:Rasal1 UTSW 5 120659563 missense probably benign 0.21
R4643:Rasal1 UTSW 5 120678964 missense probably benign 0.05
R4979:Rasal1 UTSW 5 120678676 missense probably benign
R5171:Rasal1 UTSW 5 120663764 missense probably benign
R5187:Rasal1 UTSW 5 120675395 missense probably benign 0.13
R5877:Rasal1 UTSW 5 120679070 utr 3 prime probably benign
R5924:Rasal1 UTSW 5 120675517 missense probably damaging 1.00
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6136:Rasal1 UTSW 5 120675478 missense possibly damaging 0.84
R6159:Rasal1 UTSW 5 120659608 missense probably damaging 1.00
R6548:Rasal1 UTSW 5 120674725 missense probably benign 0.00
R7042:Rasal1 UTSW 5 120663960 splice site probably null
R7194:Rasal1 UTSW 5 120675492 missense probably benign
X0057:Rasal1 UTSW 5 120664512 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCACCTCATGAGCATCAG -3'
(R):5'- AGCTATGCACCAAGAAGGAC -3'

Sequencing Primer
(F):5'- AGGTGCTTCCTAAACACTGTG -3'
(R):5'- CCTCCTGAATGCTGAGATTAGAG -3'
Posted On2018-03-15