Incidental Mutation 'R6293:Slc44a1'
ID508541
Institutional Source Beutler Lab
Gene Symbol Slc44a1
Ensembl Gene ENSMUSG00000028412
Gene Namesolute carrier family 44, member 1
SynonymsCdw92, 4833416H08Rik, CHTL1, CTL1, 2210409B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6293 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location53440413-53622478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53561099 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 605 (K605R)
Ref Sequence ENSEMBL: ENSMUSP00000103278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102911] [ENSMUST00000107645] [ENSMUST00000107647] [ENSMUST00000107651]
Predicted Effect probably damaging
Transcript: ENSMUST00000102911
AA Change: K605R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099975
Gene: ENSMUSG00000028412
AA Change: K605R

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 2.4e-107 PFAM
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107645
AA Change: K398R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103272
Gene: ENSMUSG00000028412
AA Change: K398R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Choline_transpo 83 403 4.8e-108 PFAM
low complexity region 423 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107647
AA Change: K605R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103274
Gene: ENSMUSG00000028412
AA Change: K605R

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 292 607 1.8e-105 PFAM
low complexity region 630 643 N/A INTRINSIC
transmembrane domain 682 704 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107651
AA Change: K605R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103278
Gene: ENSMUSG00000028412
AA Change: K605R

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 3.5e-108 PFAM
low complexity region 630 643 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138377
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,141,746 D323G probably damaging Het
Abcb1b T C 5: 8,853,493 I1048T probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Alkbh8 G T 9: 3,347,841 L211F possibly damaging Het
Ankrd27 T C 7: 35,608,460 S375P possibly damaging Het
Apoc1 T A 7: 19,691,892 T68S probably damaging Het
Arfgef2 T A 2: 166,873,588 Y1318N possibly damaging Het
Camsap2 C A 1: 136,287,920 R345L probably damaging Het
Ccdc38 C T 10: 93,562,797 Q46* probably null Het
Cdk12 T A 11: 98,224,553 M840K unknown Het
Col12a1 A T 9: 79,614,358 N2772K probably benign Het
Dthd1 A G 5: 62,842,850 D505G probably damaging Het
Elf1 C T 14: 79,560,786 H38Y probably damaging Het
Gcnt2 T A 13: 40,918,697 V272D probably damaging Het
Gm9964 T A 11: 79,296,594 K9M unknown Het
Gpr155 A G 2: 73,373,997 S158P possibly damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hydin A G 8: 110,597,911 S4635G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Lrrc8c A G 5: 105,606,746 Y129C probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mcm3ap C G 10: 76,471,478 Y418* probably null Het
Mpdz A G 4: 81,360,056 L764P probably damaging Het
Myt1l A G 12: 29,827,628 D426G unknown Het
Ndel1 C T 11: 68,836,275 R192H probably damaging Het
Nudt21 T C 8: 94,028,878 D134G probably damaging Het
Nup210l A T 3: 90,115,064 H113L probably damaging Het
Nxf1 A G 19: 8,769,182 K586E probably damaging Het
Olfr1191-ps1 A G 2: 88,643,280 E171G possibly damaging Het
Olfr697 T C 7: 106,741,406 H176R probably damaging Het
Osbpl8 A G 10: 111,272,238 Y365C possibly damaging Het
Pkd2l2 A G 18: 34,427,444 Y368C probably damaging Het
Pkn2 A G 3: 142,809,704 F649L probably benign Het
Pla2g4a T C 1: 149,880,047 Y205C probably damaging Het
Prex2 A G 1: 11,162,298 N863S probably benign Het
Prkdc A G 16: 15,787,155 K2979R probably benign Het
Ptk6 T C 2: 181,198,460 Y251C probably damaging Het
Rapgef6 T A 11: 54,634,781 W334R probably damaging Het
Rbm11 A T 16: 75,596,767 probably null Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rhbg G A 3: 88,245,826 R274* probably null Het
Rpp30 A G 19: 36,104,445 *269W probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Slco2a1 A G 9: 103,050,147 S80G probably benign Het
Tmem50b A T 16: 91,583,276 M71K probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyro3 A G 2: 119,808,000 T303A possibly damaging Het
Uba3 A T 6: 97,196,908 D105E probably damaging Het
Vmn1r21 T C 6: 57,844,270 D63G probably benign Het
Vstm2b T A 7: 40,900,109 I63N probably damaging Het
Wdr66 A C 5: 123,322,448 N1158H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zscan22 T A 7: 12,906,907 C359* probably null Het
Other mutations in Slc44a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc44a1 APN 4 53543571 missense probably damaging 1.00
IGL00420:Slc44a1 APN 4 53553550 missense possibly damaging 0.86
IGL01369:Slc44a1 APN 4 53491448 missense probably damaging 1.00
IGL01867:Slc44a1 APN 4 53536405 missense probably damaging 1.00
IGL02188:Slc44a1 APN 4 53541361 missense probably benign 0.01
IGL03095:Slc44a1 APN 4 53536374 nonsense probably null
R0517:Slc44a1 UTSW 4 53542366 missense probably damaging 0.99
R0815:Slc44a1 UTSW 4 53536421 missense possibly damaging 0.77
R1437:Slc44a1 UTSW 4 53561006 missense probably damaging 1.00
R1443:Slc44a1 UTSW 4 53561069 missense probably damaging 1.00
R1673:Slc44a1 UTSW 4 53542468 missense probably benign 0.04
R2037:Slc44a1 UTSW 4 53563243 intron probably benign
R2131:Slc44a1 UTSW 4 53563246 frame shift probably null
R3417:Slc44a1 UTSW 4 53553549 missense probably benign 0.04
R3721:Slc44a1 UTSW 4 53491445 missense probably damaging 1.00
R3763:Slc44a1 UTSW 4 53563286 missense probably benign 0.45
R4426:Slc44a1 UTSW 4 53563286 missense probably benign 0.45
R4751:Slc44a1 UTSW 4 53560973 missense probably damaging 1.00
R4993:Slc44a1 UTSW 4 53543644 missense probably damaging 1.00
R5853:Slc44a1 UTSW 4 53528682 missense probably benign 0.00
R6978:Slc44a1 UTSW 4 53544671 missense probably damaging 1.00
R7164:Slc44a1 UTSW 4 53528711 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATCTCAAGCATGCTCTCTGC -3'
(R):5'- AGGAAGACCTACCTCAATTTCTCC -3'

Sequencing Primer
(F):5'- TGCTGATAGTCTGCAGCAC -3'
(R):5'- ACCTCAATTTCTCCAAGATAAACTTC -3'
Posted On2018-03-15