Incidental Mutation 'R6293:Adgra3'
ID508544
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Nameadhesion G protein-coupled receptor A3
SynonymsGpr125, Tem5-like, 3830613O22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6293 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location49959956-50059006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49960847 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1120 (P1120S)
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971]
Predicted Effect probably benign
Transcript: ENSMUST00000030971
AA Change: P1120S

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: P1120S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,141,746 D323G probably damaging Het
Abcb1b T C 5: 8,853,493 I1048T probably benign Het
Alkbh8 G T 9: 3,347,841 L211F possibly damaging Het
Ankrd27 T C 7: 35,608,460 S375P possibly damaging Het
Apoc1 T A 7: 19,691,892 T68S probably damaging Het
Arfgef2 T A 2: 166,873,588 Y1318N possibly damaging Het
Camsap2 C A 1: 136,287,920 R345L probably damaging Het
Ccdc38 C T 10: 93,562,797 Q46* probably null Het
Cdk12 T A 11: 98,224,553 M840K unknown Het
Col12a1 A T 9: 79,614,358 N2772K probably benign Het
Dthd1 A G 5: 62,842,850 D505G probably damaging Het
Elf1 C T 14: 79,560,786 H38Y probably damaging Het
Gcnt2 T A 13: 40,918,697 V272D probably damaging Het
Gm9964 T A 11: 79,296,594 K9M unknown Het
Gpr155 A G 2: 73,373,997 S158P possibly damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hydin A G 8: 110,597,911 S4635G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Lrrc8c A G 5: 105,606,746 Y129C probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mcm3ap C G 10: 76,471,478 Y418* probably null Het
Mpdz A G 4: 81,360,056 L764P probably damaging Het
Myt1l A G 12: 29,827,628 D426G unknown Het
Ndel1 C T 11: 68,836,275 R192H probably damaging Het
Nudt21 T C 8: 94,028,878 D134G probably damaging Het
Nup210l A T 3: 90,115,064 H113L probably damaging Het
Nxf1 A G 19: 8,769,182 K586E probably damaging Het
Olfr1191-ps1 A G 2: 88,643,280 E171G possibly damaging Het
Olfr697 T C 7: 106,741,406 H176R probably damaging Het
Osbpl8 A G 10: 111,272,238 Y365C possibly damaging Het
Pkd2l2 A G 18: 34,427,444 Y368C probably damaging Het
Pkn2 A G 3: 142,809,704 F649L probably benign Het
Pla2g4a T C 1: 149,880,047 Y205C probably damaging Het
Prex2 A G 1: 11,162,298 N863S probably benign Het
Prkdc A G 16: 15,787,155 K2979R probably benign Het
Ptk6 T C 2: 181,198,460 Y251C probably damaging Het
Rapgef6 T A 11: 54,634,781 W334R probably damaging Het
Rbm11 A T 16: 75,596,767 probably null Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rhbg G A 3: 88,245,826 R274* probably null Het
Rpp30 A G 19: 36,104,445 *269W probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Slc44a1 A G 4: 53,561,099 K605R probably damaging Het
Slco2a1 A G 9: 103,050,147 S80G probably benign Het
Tmem50b A T 16: 91,583,276 M71K probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyro3 A G 2: 119,808,000 T303A possibly damaging Het
Uba3 A T 6: 97,196,908 D105E probably damaging Het
Vmn1r21 T C 6: 57,844,270 D63G probably benign Het
Vstm2b T A 7: 40,900,109 I63N probably damaging Het
Wdr66 A C 5: 123,322,448 N1158H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zscan22 T A 7: 12,906,907 C359* probably null Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50025758 missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50001949 missense probably damaging 1.00
IGL01455:Adgra3 APN 5 49987557 nonsense probably null
IGL01665:Adgra3 APN 5 50006930 missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 49979142 missense probably benign
IGL02239:Adgra3 APN 5 49960712 missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02358:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02938:Adgra3 APN 5 49961317 missense probably benign 0.01
IGL03028:Adgra3 APN 5 50016852 missense probably benign 0.30
aperture UTSW 5 49999145 nonsense probably null
saltatory UTSW 5 49960559 missense probably benign 0.09
ANU74:Adgra3 UTSW 5 49961038 missense probably benign 0.16
R0041:Adgra3 UTSW 5 49960559 missense probably benign 0.09
R0121:Adgra3 UTSW 5 50025786 splice site probably benign
R0125:Adgra3 UTSW 5 50001852 splice site probably benign
R0137:Adgra3 UTSW 5 49963840 splice site probably benign
R0415:Adgra3 UTSW 5 49961757 splice site probably benign
R0479:Adgra3 UTSW 5 49990265 missense probably benign 0.00
R0505:Adgra3 UTSW 5 50009334 critical splice donor site probably null
R0831:Adgra3 UTSW 5 49970802 missense probably damaging 1.00
R0883:Adgra3 UTSW 5 49960723 missense probably damaging 1.00
R0920:Adgra3 UTSW 5 49961161 missense probably benign 0.19
R1139:Adgra3 UTSW 5 49961755 splice site probably null
R1211:Adgra3 UTSW 5 50006876 missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 49960787 missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 49961137 missense probably benign 0.00
R1703:Adgra3 UTSW 5 50006775 missense probably benign 0.00
R1782:Adgra3 UTSW 5 49972062 missense probably benign 0.02
R1843:Adgra3 UTSW 5 49961492 missense probably damaging 1.00
R2157:Adgra3 UTSW 5 50001941 missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50001880 missense probably benign 0.04
R2385:Adgra3 UTSW 5 49979566 missense possibly damaging 0.95
R2426:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R3084:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3086:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3409:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R4301:Adgra3 UTSW 5 49961078 missense possibly damaging 0.94
R4360:Adgra3 UTSW 5 49990210 missense possibly damaging 0.92
R4475:Adgra3 UTSW 5 50001898 missense probably damaging 1.00
R4569:Adgra3 UTSW 5 49960563 missense probably damaging 1.00
R4607:Adgra3 UTSW 5 49970739 missense probably damaging 0.98
R4667:Adgra3 UTSW 5 49978956 missense possibly damaging 0.94
R4671:Adgra3 UTSW 5 49979368 missense probably damaging 1.00
R4886:Adgra3 UTSW 5 49999195 missense probably benign 0.07
R5197:Adgra3 UTSW 5 49960754 missense probably benign 0.01
R5208:Adgra3 UTSW 5 50011515 missense probably damaging 0.99
R5313:Adgra3 UTSW 5 49961309 missense probably benign 0.24
R5435:Adgra3 UTSW 5 49990126 missense probably damaging 0.99
R5663:Adgra3 UTSW 5 49999285 missense probably benign 0.14
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6064:Adgra3 UTSW 5 49960325 missense probably damaging 0.97
R6259:Adgra3 UTSW 5 49999141 missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R6296:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6297:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6352:Adgra3 UTSW 5 49979136 missense probably benign
R6352:Adgra3 UTSW 5 49990250 missense probably benign 0.01
R6989:Adgra3 UTSW 5 50006884 missense probably damaging 1.00
X0065:Adgra3 UTSW 5 49971962 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGCATACTCTCGCAGGAC -3'
(R):5'- ATCATGATGTGCTGCCCAGG -3'

Sequencing Primer
(F):5'- AGGACTGTGAGCCTGCTG -3'
(R):5'- GTACTCCGTGCAAGTCAACGTC -3'
Posted On2018-03-15