Incidental Mutation 'R6293:Ndel1'
ID508566
Institutional Source Beutler Lab
Gene Symbol Ndel1
Ensembl Gene ENSMUSG00000018736
Gene NamenudE neurodevelopment protein 1 like 1
Synonyms2600006O07Rik, mNudel
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6293 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68821434-68871858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68836275 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 192 (R192H)
Ref Sequence ENSEMBL: ENSMUSP00000104312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018880] [ENSMUST00000101017] [ENSMUST00000108672]
Predicted Effect probably damaging
Transcript: ENSMUST00000018880
AA Change: R192H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018880
Gene: ENSMUSG00000018736
AA Change: R192H

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
Pfam:NUDE_C 135 309 6.6e-49 PFAM
low complexity region 322 339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101017
AA Change: R192H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098579
Gene: ENSMUSG00000018736
AA Change: R192H

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
Pfam:NUDE_C 135 315 9.3e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108672
AA Change: R192H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104312
Gene: ENSMUSG00000018736
AA Change: R192H

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
Pfam:NUDE_C 135 315 9.3e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144300
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil protein that plays a role in multiple processes including cytoskeletal organization, cell signaling and neuron migration, outgrowth and maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous inactivation of this gene causes peri-implantation lethality. Blastocysts fail to grow in culture and exhibit inner cell mass degeneration. Compound heterozygous mice carrying one null and one hypomorphic allele show mild neuronal migration defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,141,746 D323G probably damaging Het
Abcb1b T C 5: 8,853,493 I1048T probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Alkbh8 G T 9: 3,347,841 L211F possibly damaging Het
Ankrd27 T C 7: 35,608,460 S375P possibly damaging Het
Apoc1 T A 7: 19,691,892 T68S probably damaging Het
Arfgef2 T A 2: 166,873,588 Y1318N possibly damaging Het
Camsap2 C A 1: 136,287,920 R345L probably damaging Het
Ccdc38 C T 10: 93,562,797 Q46* probably null Het
Cdk12 T A 11: 98,224,553 M840K unknown Het
Col12a1 A T 9: 79,614,358 N2772K probably benign Het
Dthd1 A G 5: 62,842,850 D505G probably damaging Het
Elf1 C T 14: 79,560,786 H38Y probably damaging Het
Gcnt2 T A 13: 40,918,697 V272D probably damaging Het
Gm9964 T A 11: 79,296,594 K9M unknown Het
Gpr155 A G 2: 73,373,997 S158P possibly damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hmcn2 T C 2: 31,335,451 I124T probably damaging Het
Hydin A G 8: 110,597,911 S4635G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Lrrc8c A G 5: 105,606,746 Y129C probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mcm3ap C G 10: 76,471,478 Y418* probably null Het
Mpdz A G 4: 81,360,056 L764P probably damaging Het
Myt1l A G 12: 29,827,628 D426G unknown Het
Nudt21 T C 8: 94,028,878 D134G probably damaging Het
Nup210l A T 3: 90,115,064 H113L probably damaging Het
Nxf1 A G 19: 8,769,182 K586E probably damaging Het
Olfr1191-ps1 A G 2: 88,643,280 E171G possibly damaging Het
Olfr697 T C 7: 106,741,406 H176R probably damaging Het
Osbpl8 A G 10: 111,272,238 Y365C possibly damaging Het
Pkd2l2 A G 18: 34,427,444 Y368C probably damaging Het
Pkn2 A G 3: 142,809,704 F649L probably benign Het
Pla2g4a T C 1: 149,880,047 Y205C probably damaging Het
Prex2 A G 1: 11,162,298 N863S probably benign Het
Prkdc A G 16: 15,787,155 K2979R probably benign Het
Ptk6 T C 2: 181,198,460 Y251C probably damaging Het
Rapgef6 T A 11: 54,634,781 W334R probably damaging Het
Rbm11 A T 16: 75,596,767 probably null Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rhbg G A 3: 88,245,826 R274* probably null Het
Rpp30 A G 19: 36,104,445 *269W probably null Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Homo
Slc44a1 A G 4: 53,561,099 K605R probably damaging Het
Slco2a1 A G 9: 103,050,147 S80G probably benign Het
Tmem50b A T 16: 91,583,276 M71K probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyro3 A G 2: 119,808,000 T303A possibly damaging Het
Uba3 A T 6: 97,196,908 D105E probably damaging Het
Vmn1r21 T C 6: 57,844,270 D63G probably benign Het
Vstm2b T A 7: 40,900,109 I63N probably damaging Het
Wdr66 A C 5: 123,322,448 N1158H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zscan22 T A 7: 12,906,907 C359* probably null Het
Other mutations in Ndel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03236:Ndel1 APN 11 68842150 missense probably benign 0.05
FR4342:Ndel1 UTSW 11 68833409 missense probably damaging 0.97
R0025:Ndel1 UTSW 11 68836173 missense probably damaging 0.97
R0088:Ndel1 UTSW 11 68833420 missense probably damaging 0.98
R1510:Ndel1 UTSW 11 68822656 missense possibly damaging 0.80
R1944:Ndel1 UTSW 11 68829920 missense probably benign
R4710:Ndel1 UTSW 11 68845337 missense probably damaging 0.99
R5940:Ndel1 UTSW 11 68822571 utr 3 prime probably benign
R6678:Ndel1 UTSW 11 68833413 missense possibly damaging 0.87
R7043:Ndel1 UTSW 11 68822624 missense possibly damaging 0.70
R7107:Ndel1 UTSW 11 68822648 missense possibly damaging 0.90
X0013:Ndel1 UTSW 11 68839988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACGCAGAACTGTAGCAGC -3'
(R):5'- AAGTTCTAGGGGAGTTCACATTTTG -3'

Sequencing Primer
(F):5'- CTAACATGGCCTTCAAGAG -3'
(R):5'- AGGGGAGTTCACATTTTGTTAAAGAG -3'
Posted On2018-03-15