Incidental Mutation 'R6294:Olfr1318'
ID508587
Institutional Source Beutler Lab
Gene Symbol Olfr1318
Ensembl Gene ENSMUSG00000049758
Gene Nameolfactory receptor 1318
SynonymsMOR245-16, GA_x6K02T2Q125-73202172-73203134
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6294 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112154198-112159157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112156019 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 23 (I23V)
Ref Sequence ENSEMBL: ENSMUSP00000151164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058176] [ENSMUST00000214063] [ENSMUST00000217533]
Predicted Effect probably benign
Transcript: ENSMUST00000058176
AA Change: I23V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051938
Gene: ENSMUSG00000049758
AA Change: I23V

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 2.4e-39 PFAM
Pfam:7tm_1 41 287 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214063
AA Change: I23V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216873
Predicted Effect probably benign
Transcript: ENSMUST00000217533
AA Change: I23V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,654,481 H579L probably benign Het
Aldh2 G A 5: 121,572,816 Q8* probably null Het
Ankdd1a G T 9: 65,520,164 H10Q probably benign Het
Arpp21 A G 9: 112,127,452 F453L probably damaging Het
Birc6 C A 17: 74,689,257 D4461E probably benign Het
Cacna1b A T 2: 24,719,057 S411T possibly damaging Het
Camk2g A G 14: 20,764,949 I203T probably damaging Het
Cat A T 2: 103,460,295 C425S probably benign Het
Ccdc34 A G 2: 110,018,151 D95G probably benign Het
Clca4b T C 3: 144,925,185 S305G probably null Het
Cul7 T C 17: 46,663,148 I1453T probably benign Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 K561T probably benign Het
Erbin T C 13: 103,857,056 T359A probably benign Het
Far2 T A 6: 148,157,482 L222Q probably damaging Het
Fbxw17 A G 13: 50,423,803 E114G probably benign Het
Fryl A T 5: 73,191,759 probably benign Het
Ggn A G 7: 29,173,848 D666G possibly damaging Het
Hal G A 10: 93,514,143 probably null Het
Htt A G 5: 34,821,826 D851G probably benign Het
Ighv14-2 A T 12: 113,994,598 D74E probably benign Het
Igkv5-43 G A 6: 69,823,442 S87L probably damaging Het
Klhl29 A T 12: 5,083,995 F720I probably damaging Het
Klk1b8 T A 7: 43,952,772 Y43N probably damaging Het
Krtap6-3 T A 16: 89,084,101 Y7N unknown Het
Lama4 T A 10: 39,075,470 F1070L probably damaging Het
Map4 A G 9: 110,002,746 E98G possibly damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mki67 A G 7: 135,704,590 M581T probably benign Het
Mtss1l T A 8: 110,727,328 N43K possibly damaging Het
Mylk3 T A 8: 85,350,383 I475F probably damaging Het
Nat14 C T 7: 4,924,074 R82* probably null Het
Nckap1 T C 2: 80,541,514 N324S probably benign Het
Nemp1 C T 10: 127,694,522 T281M possibly damaging Het
Nrg3 A T 14: 38,397,239 H425Q probably benign Het
Olfr101 T A 17: 37,299,553 T290S probably benign Het
Olfr1487 T C 19: 13,619,366 V25A probably benign Het
Olfr584 A T 7: 103,085,667 I45F probably benign Het
Olfr622 A G 7: 103,639,591 M183T probably damaging Het
Olfr95 T C 17: 37,211,626 T76A probably benign Het
Omd T A 13: 49,589,991 N172K probably damaging Het
Orc1 T C 4: 108,590,670 I38T probably benign Het
Oxct1 A G 15: 4,142,822 T457A possibly damaging Het
Pcdh17 A T 14: 84,477,668 K924N probably benign Het
Pkhd1l1 A T 15: 44,570,028 I3435F probably damaging Het
Psg20 C A 7: 18,682,679 V171F probably damaging Het
Rab11fip2 A T 19: 59,937,099 S87T probably damaging Het
Rabgap1l T C 1: 160,231,849 T237A probably benign Het
Rasgrp1 A T 2: 117,291,792 Y372* probably null Het
Rell1 G T 5: 63,939,705 probably benign Het
Rps14 A G 18: 60,776,961 K61E possibly damaging Het
Rtl6 A G 15: 84,557,120 V25A possibly damaging Het
Ryr2 G T 13: 11,879,496 S185R probably damaging Het
Slc10a2 C T 8: 5,091,621 probably null Het
Slc14a1 T A 18: 78,110,058 probably null Het
Smad2 A T 18: 76,289,162 N215I probably benign Het
Smchd1 A T 17: 71,370,927 N1473K probably benign Het
Spag9 A G 11: 94,093,485 probably null Het
Stk31 A C 6: 49,417,344 R213S probably benign Het
Tmod4 A T 3: 95,128,306 Q255L probably benign Het
Tnpo1 T A 13: 98,890,774 Y3F probably benign Het
Tom1l1 A C 11: 90,661,761 Y206* probably null Het
Tulp2 A G 7: 45,514,692 K36E probably damaging Het
Tulp4 C T 17: 6,201,819 R282C probably damaging Het
Unc5b A T 10: 60,778,331 N246K possibly damaging Het
Ush2a C G 1: 188,536,370 S1674R possibly damaging Het
Vmn1r224 T C 17: 20,419,821 I220T probably benign Het
Vmn1r7 G C 6: 57,024,419 N285K probably benign Het
Vmn2r83 C T 10: 79,477,854 P99S probably damaging Het
Zbtb38 A G 9: 96,687,229 F601L probably benign Het
Zc3h3 A T 15: 75,809,568 S555T possibly damaging Het
Other mutations in Olfr1318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr1318 APN 2 112156067 missense probably benign
IGL00923:Olfr1318 APN 2 112156777 missense possibly damaging 0.75
IGL02800:Olfr1318 APN 2 112156244 missense possibly damaging 0.95
R0012:Olfr1318 UTSW 2 112156826 missense possibly damaging 0.84
R1614:Olfr1318 UTSW 2 112156517 missense probably damaging 1.00
R1989:Olfr1318 UTSW 2 112156377 missense probably benign 0.00
R2428:Olfr1318 UTSW 2 112156442 missense probably benign 0.03
R2963:Olfr1318 UTSW 2 112156459 nonsense probably null
R4868:Olfr1318 UTSW 2 112156571 missense probably damaging 0.99
R4960:Olfr1318 UTSW 2 112156352 missense probably benign 0.00
R5121:Olfr1318 UTSW 2 112156286 missense possibly damaging 0.47
R6218:Olfr1318 UTSW 2 112156356 missense probably damaging 0.99
R6350:Olfr1318 UTSW 2 112156197 missense probably damaging 0.99
R6515:Olfr1318 UTSW 2 112156365 missense probably benign 0.00
R6722:Olfr1318 UTSW 2 112156882 missense probably benign
R6829:Olfr1318 UTSW 2 112155794 intron probably benign
R7186:Olfr1318 UTSW 2 112156162 missense probably damaging 1.00
R7206:Olfr1318 UTSW 2 112156459 missense probably damaging 1.00
R7444:Olfr1318 UTSW 2 112156715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGCAGGTTGTCTTGGG -3'
(R):5'- TCAAGGAGATGACTTTGTGCTTTC -3'

Sequencing Primer
(F):5'- CAGCAGGTTGTCTTGGGGTTTTG -3'
(R):5'- GGTCATAAATCATCTTTGGAGTAGCG -3'
Posted On2018-03-15