Incidental Mutation 'R6294:Aldh2'
ID508594
Institutional Source Beutler Lab
Gene Symbol Aldh2
Ensembl Gene ENSMUSG00000029455
Gene Namealdehyde dehydrogenase 2, mitochondrial
SynonymsAhd5, Ahd-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6294 (G1)
Quality Score80.0075
Status Validated
Chromosome5
Chromosomal Location121566027-121593824 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 121572816 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 8 (Q8*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031411] [ENSMUST00000129753] [ENSMUST00000152945] [ENSMUST00000199369]
Predicted Effect probably null
Transcript: ENSMUST00000031411
AA Change: Q317*
SMART Domains Protein: ENSMUSP00000031411
Gene: ENSMUSG00000029455
AA Change: Q317*

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 510 2.9e-185 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129753
AA Change: Q317*
SMART Domains Protein: ENSMUSP00000142906
Gene: ENSMUSG00000029455
AA Change: Q317*

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 471 1e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133033
Predicted Effect probably benign
Transcript: ENSMUST00000152945
SMART Domains Protein: ENSMUSP00000123545
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 185 1.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196694
Predicted Effect probably benign
Transcript: ENSMUST00000199369
SMART Domains Protein: ENSMUSP00000143261
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
Pfam:Aldedh 1 129 4.2e-43 PFAM
Pfam:Aldedh 125 220 3.6e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200541
AA Change: Q8*
Meta Mutation Damage Score 0.594 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. Two major liver isoforms of aldehyde dehydrogenase, cytosolic and mitochondrial, can be distinguished by their electrophoretic mobilities, kinetic properties, and subcellular localizations. Most Caucasians have two major isozymes, while approximately 50% of East Asians have the cytosolic isozyme but not the mitochondrial isozyme. A remarkably higher frequency of acute alcohol intoxication among East Asians than among Caucasians could be related to the absence of a catalytically active form of the mitochondrial isozyme. The increased exposure to acetaldehyde in individuals with the catalytically inactive form may also confer greater susceptibility to many types of cancer. This gene encodes a mitochondrial isoform, which has a low Km for acetaldehydes, and is localized in mitochondrial matrix. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutation of this gene results in the absence of oxidation activity in the mitochondria. Mice homozygous for a different allele exhibit decreased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,654,481 H579L probably benign Het
Ankdd1a G T 9: 65,520,164 H10Q probably benign Het
Arpp21 A G 9: 112,127,452 F453L probably damaging Het
Birc6 C A 17: 74,689,257 D4461E probably benign Het
Cacna1b A T 2: 24,719,057 S411T possibly damaging Het
Camk2g A G 14: 20,764,949 I203T probably damaging Het
Cat A T 2: 103,460,295 C425S probably benign Het
Ccdc34 A G 2: 110,018,151 D95G probably benign Het
Clca4b T C 3: 144,925,185 S305G probably null Het
Cul7 T C 17: 46,663,148 I1453T probably benign Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 K561T probably benign Het
Erbin T C 13: 103,857,056 T359A probably benign Het
Far2 T A 6: 148,157,482 L222Q probably damaging Het
Fbxw17 A G 13: 50,423,803 E114G probably benign Het
Fryl A T 5: 73,191,759 probably benign Het
Ggn A G 7: 29,173,848 D666G possibly damaging Het
Hal G A 10: 93,514,143 probably null Het
Htt A G 5: 34,821,826 D851G probably benign Het
Ighv14-2 A T 12: 113,994,598 D74E probably benign Het
Igkv5-43 G A 6: 69,823,442 S87L probably damaging Het
Klhl29 A T 12: 5,083,995 F720I probably damaging Het
Klk1b8 T A 7: 43,952,772 Y43N probably damaging Het
Krtap6-3 T A 16: 89,084,101 Y7N unknown Het
Lama4 T A 10: 39,075,470 F1070L probably damaging Het
Map4 A G 9: 110,002,746 E98G possibly damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mki67 A G 7: 135,704,590 M581T probably benign Het
Mtss1l T A 8: 110,727,328 N43K possibly damaging Het
Mylk3 T A 8: 85,350,383 I475F probably damaging Het
Nat14 C T 7: 4,924,074 R82* probably null Het
Nckap1 T C 2: 80,541,514 N324S probably benign Het
Nemp1 C T 10: 127,694,522 T281M possibly damaging Het
Nrg3 A T 14: 38,397,239 H425Q probably benign Het
Olfr101 T A 17: 37,299,553 T290S probably benign Het
Olfr1318 A G 2: 112,156,019 I23V probably benign Het
Olfr1487 T C 19: 13,619,366 V25A probably benign Het
Olfr584 A T 7: 103,085,667 I45F probably benign Het
Olfr622 A G 7: 103,639,591 M183T probably damaging Het
Olfr95 T C 17: 37,211,626 T76A probably benign Het
Omd T A 13: 49,589,991 N172K probably damaging Het
Orc1 T C 4: 108,590,670 I38T probably benign Het
Oxct1 A G 15: 4,142,822 T457A possibly damaging Het
Pcdh17 A T 14: 84,477,668 K924N probably benign Het
Pkhd1l1 A T 15: 44,570,028 I3435F probably damaging Het
Psg20 C A 7: 18,682,679 V171F probably damaging Het
Rab11fip2 A T 19: 59,937,099 S87T probably damaging Het
Rabgap1l T C 1: 160,231,849 T237A probably benign Het
Rasgrp1 A T 2: 117,291,792 Y372* probably null Het
Rell1 G T 5: 63,939,705 probably benign Het
Rps14 A G 18: 60,776,961 K61E possibly damaging Het
Rtl6 A G 15: 84,557,120 V25A possibly damaging Het
Ryr2 G T 13: 11,879,496 S185R probably damaging Het
Slc10a2 C T 8: 5,091,621 probably null Het
Slc14a1 T A 18: 78,110,058 probably null Het
Smad2 A T 18: 76,289,162 N215I probably benign Het
Smchd1 A T 17: 71,370,927 N1473K probably benign Het
Spag9 A G 11: 94,093,485 probably null Het
Stk31 A C 6: 49,417,344 R213S probably benign Het
Tmod4 A T 3: 95,128,306 Q255L probably benign Het
Tnpo1 T A 13: 98,890,774 Y3F probably benign Het
Tom1l1 A C 11: 90,661,761 Y206* probably null Het
Tulp2 A G 7: 45,514,692 K36E probably damaging Het
Tulp4 C T 17: 6,201,819 R282C probably damaging Het
Unc5b A T 10: 60,778,331 N246K possibly damaging Het
Ush2a C G 1: 188,536,370 S1674R possibly damaging Het
Vmn1r224 T C 17: 20,419,821 I220T probably benign Het
Vmn1r7 G C 6: 57,024,419 N285K probably benign Het
Vmn2r83 C T 10: 79,477,854 P99S probably damaging Het
Zbtb38 A G 9: 96,687,229 F601L probably benign Het
Zc3h3 A T 15: 75,809,568 S555T possibly damaging Het
Other mutations in Aldh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Aldh2 APN 5 121572073 missense probably benign 0.00
IGL02145:Aldh2 APN 5 121567993 makesense probably null
IGL02352:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02359:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02473:Aldh2 APN 5 121572078 missense probably damaging 1.00
IGL02818:Aldh2 APN 5 121575125 missense probably benign
IGL03182:Aldh2 APN 5 121580724 unclassified probably benign
IGL03324:Aldh2 APN 5 121575125 missense probably benign
flushed UTSW 5 121572816 nonsense probably null
R0595:Aldh2 UTSW 5 121573500 missense probably damaging 0.99
R0595:Aldh2 UTSW 5 121573501 missense probably damaging 0.97
R1697:Aldh2 UTSW 5 121578341 critical splice donor site probably null
R1992:Aldh2 UTSW 5 121575963 missense possibly damaging 0.93
R2174:Aldh2 UTSW 5 121572668 intron probably benign
R4786:Aldh2 UTSW 5 121572824 missense probably benign 0.21
R4793:Aldh2 UTSW 5 121568979 missense probably damaging 0.99
R5408:Aldh2 UTSW 5 121570557 intron probably benign
R5934:Aldh2 UTSW 5 121579615 missense probably benign
R6266:Aldh2 UTSW 5 121568934 missense probably damaging 0.97
R6792:Aldh2 UTSW 5 121580649 missense probably damaging 0.98
X0009:Aldh2 UTSW 5 121572774 missense possibly damaging 0.94
X0027:Aldh2 UTSW 5 121593462 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGCTTTGGCACACTGGC -3'
(R):5'- CAAGGGAAGAGGGTTCTGTTTC -3'

Sequencing Primer
(F):5'- ACACTGGCTTTGGACTCCAG -3'
(R):5'- CTGTTTCATTCTGGCCAGGAATTG -3'
Posted On2018-03-15