Incidental Mutation 'R6294:Far2'
ID508599
Institutional Source Beutler Lab
Gene Symbol Far2
Ensembl Gene ENSMUSG00000030303
Gene Namefatty acyl CoA reductase 2
SynonymsMlstd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6294 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location148047259-148182758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148157482 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 222 (L222Q)
Ref Sequence ENSEMBL: ENSMUSP00000107234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032443] [ENSMUST00000111607]
Predicted Effect probably damaging
Transcript: ENSMUST00000032443
AA Change: L222Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032443
Gene: ENSMUSG00000030303
AA Change: L222Q

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 160 5.3e-8 PFAM
Pfam:Epimerase 13 242 7.5e-9 PFAM
Pfam:3Beta_HSD 14 167 3.4e-7 PFAM
Pfam:NAD_binding_4 15 285 3.3e-76 PFAM
Pfam:Sterile 356 448 4.3e-35 PFAM
transmembrane domain 465 484 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111607
AA Change: L222Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107234
Gene: ENSMUSG00000030303
AA Change: L222Q

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.9e-8 PFAM
Pfam:Epimerase 13 241 3.2e-10 PFAM
Pfam:3Beta_HSD 14 167 4.2e-7 PFAM
Pfam:NAD_binding_4 15 285 3.2e-73 PFAM
Pfam:Sterile 355 448 1.2e-29 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the short chain dehydrogenase/reductase superfamily. It encodes a reductase enzyme involved in the first step of wax biosynthesis wherein fatty acids are converted to fatty alcohols. The encoded peroxisomal protein utilizes saturated fatty acids of 16 or 18 carbons as preferred substrates. Alternatively spliced transcript variants have been observed for this gene. Related pseudogenes have been identified on chromosomes 2, 14 and 22. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,654,481 H579L probably benign Het
Aldh2 G A 5: 121,572,816 Q8* probably null Het
Ankdd1a G T 9: 65,520,164 H10Q probably benign Het
Arpp21 A G 9: 112,127,452 F453L probably damaging Het
Birc6 C A 17: 74,689,257 D4461E probably benign Het
Cacna1b A T 2: 24,719,057 S411T possibly damaging Het
Camk2g A G 14: 20,764,949 I203T probably damaging Het
Cat A T 2: 103,460,295 C425S probably benign Het
Ccdc34 A G 2: 110,018,151 D95G probably benign Het
Clca4b T C 3: 144,925,185 S305G probably null Het
Cul7 T C 17: 46,663,148 I1453T probably benign Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 K561T probably benign Het
Erbin T C 13: 103,857,056 T359A probably benign Het
Fbxw17 A G 13: 50,423,803 E114G probably benign Het
Fryl A T 5: 73,191,759 probably benign Het
Ggn A G 7: 29,173,848 D666G possibly damaging Het
Hal G A 10: 93,514,143 probably null Het
Htt A G 5: 34,821,826 D851G probably benign Het
Ighv14-2 A T 12: 113,994,598 D74E probably benign Het
Igkv5-43 G A 6: 69,823,442 S87L probably damaging Het
Klhl29 A T 12: 5,083,995 F720I probably damaging Het
Klk1b8 T A 7: 43,952,772 Y43N probably damaging Het
Krtap6-3 T A 16: 89,084,101 Y7N unknown Het
Lama4 T A 10: 39,075,470 F1070L probably damaging Het
Map4 A G 9: 110,002,746 E98G possibly damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mki67 A G 7: 135,704,590 M581T probably benign Het
Mtss1l T A 8: 110,727,328 N43K possibly damaging Het
Mylk3 T A 8: 85,350,383 I475F probably damaging Het
Nat14 C T 7: 4,924,074 R82* probably null Het
Nckap1 T C 2: 80,541,514 N324S probably benign Het
Nemp1 C T 10: 127,694,522 T281M possibly damaging Het
Nrg3 A T 14: 38,397,239 H425Q probably benign Het
Olfr101 T A 17: 37,299,553 T290S probably benign Het
Olfr1318 A G 2: 112,156,019 I23V probably benign Het
Olfr1487 T C 19: 13,619,366 V25A probably benign Het
Olfr584 A T 7: 103,085,667 I45F probably benign Het
Olfr622 A G 7: 103,639,591 M183T probably damaging Het
Olfr95 T C 17: 37,211,626 T76A probably benign Het
Omd T A 13: 49,589,991 N172K probably damaging Het
Orc1 T C 4: 108,590,670 I38T probably benign Het
Oxct1 A G 15: 4,142,822 T457A possibly damaging Het
Pcdh17 A T 14: 84,477,668 K924N probably benign Het
Pkhd1l1 A T 15: 44,570,028 I3435F probably damaging Het
Psg20 C A 7: 18,682,679 V171F probably damaging Het
Rab11fip2 A T 19: 59,937,099 S87T probably damaging Het
Rabgap1l T C 1: 160,231,849 T237A probably benign Het
Rasgrp1 A T 2: 117,291,792 Y372* probably null Het
Rell1 G T 5: 63,939,705 probably benign Het
Rps14 A G 18: 60,776,961 K61E possibly damaging Het
Rtl6 A G 15: 84,557,120 V25A possibly damaging Het
Ryr2 G T 13: 11,879,496 S185R probably damaging Het
Slc10a2 C T 8: 5,091,621 probably null Het
Slc14a1 T A 18: 78,110,058 probably null Het
Smad2 A T 18: 76,289,162 N215I probably benign Het
Smchd1 A T 17: 71,370,927 N1473K probably benign Het
Spag9 A G 11: 94,093,485 probably null Het
Stk31 A C 6: 49,417,344 R213S probably benign Het
Tmod4 A T 3: 95,128,306 Q255L probably benign Het
Tnpo1 T A 13: 98,890,774 Y3F probably benign Het
Tom1l1 A C 11: 90,661,761 Y206* probably null Het
Tulp2 A G 7: 45,514,692 K36E probably damaging Het
Tulp4 C T 17: 6,201,819 R282C probably damaging Het
Unc5b A T 10: 60,778,331 N246K possibly damaging Het
Ush2a C G 1: 188,536,370 S1674R possibly damaging Het
Vmn1r224 T C 17: 20,419,821 I220T probably benign Het
Vmn1r7 G C 6: 57,024,419 N285K probably benign Het
Vmn2r83 C T 10: 79,477,854 P99S probably damaging Het
Zbtb38 A G 9: 96,687,229 F601L probably benign Het
Zc3h3 A T 15: 75,809,568 S555T possibly damaging Het
Other mutations in Far2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Far2 APN 6 148150598 missense possibly damaging 0.89
IGL01650:Far2 APN 6 148173487 missense possibly damaging 0.92
IGL01899:Far2 APN 6 148146029 missense probably benign 0.19
IGL02524:Far2 APN 6 148150658 missense probably damaging 1.00
IGL02756:Far2 APN 6 148157391 missense probably damaging 1.00
galway UTSW 6 148157482 missense probably damaging 0.99
PIT4531001:Far2 UTSW 6 148175131 missense possibly damaging 0.95
R0319:Far2 UTSW 6 148157470 missense probably damaging 0.96
R0654:Far2 UTSW 6 148175141 missense possibly damaging 0.64
R1321:Far2 UTSW 6 148173536 splice site probably benign
R1610:Far2 UTSW 6 148157458 missense possibly damaging 0.71
R2039:Far2 UTSW 6 148165577 missense probably benign
R2471:Far2 UTSW 6 148138694 missense probably damaging 1.00
R3874:Far2 UTSW 6 148150591 missense probably benign 0.00
R3875:Far2 UTSW 6 148150591 missense probably benign 0.00
R3974:Far2 UTSW 6 148150754 missense probably damaging 0.96
R4490:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R4491:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R5034:Far2 UTSW 6 148173441 missense probably benign 0.43
R5421:Far2 UTSW 6 148146192 splice site probably null
R5673:Far2 UTSW 6 148146104 missense possibly damaging 0.86
R6092:Far2 UTSW 6 148175083 missense probably benign 0.00
R6325:Far2 UTSW 6 148157497 missense probably benign 0.30
R6783:Far2 UTSW 6 148150775 splice site probably null
R7380:Far2 UTSW 6 148180995 missense unknown
R7403:Far2 UTSW 6 148158977 missense possibly damaging 0.93
R7484:Far2 UTSW 6 148173913 missense probably damaging 1.00
X0053:Far2 UTSW 6 148165640 missense probably benign 0.00
Z1088:Far2 UTSW 6 148138658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGAAGTTTCATTTGACTGG -3'
(R):5'- TGTGCACACCCATTTGTAATAC -3'

Sequencing Primer
(F):5'- CAGAAGTTTCATTTGACTGGCTGTG -3'
(R):5'- GCACACCCATTTGTAATACTAATTGG -3'
Posted On2018-03-15