Incidental Mutation 'R6294:Tom1l1'
ID508621
Institutional Source Beutler Lab
Gene Symbol Tom1l1
Ensembl Gene ENSMUSG00000020541
Gene Nametarget of myb1-like 1 (chicken)
Synonyms2310045L10Rik, Srcasm
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R6294 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location90643465-90688366 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 90661761 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 206 (Y206*)
Ref Sequence ENSEMBL: ENSMUSP00000103501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020849] [ENSMUST00000107867] [ENSMUST00000107868] [ENSMUST00000107869]
Predicted Effect probably null
Transcript: ENSMUST00000020849
AA Change: Y282*
SMART Domains Protein: ENSMUSP00000020849
Gene: ENSMUSG00000020541
AA Change: Y282*

DomainStartEndE-ValueType
VHS 15 150 7.37e-53 SMART
Pfam:GAT 212 288 5.8e-17 PFAM
low complexity region 340 349 N/A INTRINSIC
low complexity region 409 416 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107867
AA Change: Y35*
SMART Domains Protein: ENSMUSP00000103499
Gene: ENSMUSG00000020541
AA Change: Y35*

DomainStartEndE-ValueType
Pfam:GAT 1 50 5.4e-12 PFAM
low complexity region 93 102 N/A INTRINSIC
low complexity region 162 169 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107868
AA Change: Y205*
SMART Domains Protein: ENSMUSP00000103500
Gene: ENSMUSG00000020541
AA Change: Y205*

DomainStartEndE-ValueType
Pfam:VHS 1 73 4.2e-10 PFAM
Pfam:GAT 119 220 5.5e-29 PFAM
low complexity region 263 272 N/A INTRINSIC
low complexity region 332 339 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107869
AA Change: Y206*
SMART Domains Protein: ENSMUSP00000103501
Gene: ENSMUSG00000020541
AA Change: Y206*

DomainStartEndE-ValueType
VHS 15 152 7.23e-38 SMART
low complexity region 264 273 N/A INTRINSIC
low complexity region 333 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147329
Meta Mutation Damage Score 0.62 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,654,481 H579L probably benign Het
Aldh2 G A 5: 121,572,816 Q8* probably null Het
Ankdd1a G T 9: 65,520,164 H10Q probably benign Het
Arpp21 A G 9: 112,127,452 F453L probably damaging Het
Birc6 C A 17: 74,689,257 D4461E probably benign Het
Cacna1b A T 2: 24,719,057 S411T possibly damaging Het
Camk2g A G 14: 20,764,949 I203T probably damaging Het
Cat A T 2: 103,460,295 C425S probably benign Het
Ccdc34 A G 2: 110,018,151 D95G probably benign Het
Clca4b T C 3: 144,925,185 S305G probably null Het
Cul7 T C 17: 46,663,148 I1453T probably benign Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 K561T probably benign Het
Erbin T C 13: 103,857,056 T359A probably benign Het
Far2 T A 6: 148,157,482 L222Q probably damaging Het
Fbxw17 A G 13: 50,423,803 E114G probably benign Het
Fryl A T 5: 73,191,759 probably benign Het
Ggn A G 7: 29,173,848 D666G possibly damaging Het
Hal G A 10: 93,514,143 probably null Het
Htt A G 5: 34,821,826 D851G probably benign Het
Ighv14-2 A T 12: 113,994,598 D74E probably benign Het
Igkv5-43 G A 6: 69,823,442 S87L probably damaging Het
Klhl29 A T 12: 5,083,995 F720I probably damaging Het
Klk1b8 T A 7: 43,952,772 Y43N probably damaging Het
Krtap6-3 T A 16: 89,084,101 Y7N unknown Het
Lama4 T A 10: 39,075,470 F1070L probably damaging Het
Map4 A G 9: 110,002,746 E98G possibly damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mki67 A G 7: 135,704,590 M581T probably benign Het
Mtss1l T A 8: 110,727,328 N43K possibly damaging Het
Mylk3 T A 8: 85,350,383 I475F probably damaging Het
Nat14 C T 7: 4,924,074 R82* probably null Het
Nckap1 T C 2: 80,541,514 N324S probably benign Het
Nemp1 C T 10: 127,694,522 T281M possibly damaging Het
Nrg3 A T 14: 38,397,239 H425Q probably benign Het
Olfr101 T A 17: 37,299,553 T290S probably benign Het
Olfr1318 A G 2: 112,156,019 I23V probably benign Het
Olfr1487 T C 19: 13,619,366 V25A probably benign Het
Olfr584 A T 7: 103,085,667 I45F probably benign Het
Olfr622 A G 7: 103,639,591 M183T probably damaging Het
Olfr95 T C 17: 37,211,626 T76A probably benign Het
Omd T A 13: 49,589,991 N172K probably damaging Het
Orc1 T C 4: 108,590,670 I38T probably benign Het
Oxct1 A G 15: 4,142,822 T457A possibly damaging Het
Pcdh17 A T 14: 84,477,668 K924N probably benign Het
Pkhd1l1 A T 15: 44,570,028 I3435F probably damaging Het
Psg20 C A 7: 18,682,679 V171F probably damaging Het
Rab11fip2 A T 19: 59,937,099 S87T probably damaging Het
Rabgap1l T C 1: 160,231,849 T237A probably benign Het
Rasgrp1 A T 2: 117,291,792 Y372* probably null Het
Rell1 G T 5: 63,939,705 probably benign Het
Rps14 A G 18: 60,776,961 K61E possibly damaging Het
Rtl6 A G 15: 84,557,120 V25A possibly damaging Het
Ryr2 G T 13: 11,879,496 S185R probably damaging Het
Slc10a2 C T 8: 5,091,621 probably null Het
Slc14a1 T A 18: 78,110,058 probably null Het
Smad2 A T 18: 76,289,162 N215I probably benign Het
Smchd1 A T 17: 71,370,927 N1473K probably benign Het
Spag9 A G 11: 94,093,485 probably null Het
Stk31 A C 6: 49,417,344 R213S probably benign Het
Tmod4 A T 3: 95,128,306 Q255L probably benign Het
Tnpo1 T A 13: 98,890,774 Y3F probably benign Het
Tulp2 A G 7: 45,514,692 K36E probably damaging Het
Tulp4 C T 17: 6,201,819 R282C probably damaging Het
Unc5b A T 10: 60,778,331 N246K possibly damaging Het
Ush2a C G 1: 188,536,370 S1674R possibly damaging Het
Vmn1r224 T C 17: 20,419,821 I220T probably benign Het
Vmn1r7 G C 6: 57,024,419 N285K probably benign Het
Vmn2r83 C T 10: 79,477,854 P99S probably damaging Het
Zbtb38 A G 9: 96,687,229 F601L probably benign Het
Zc3h3 A T 15: 75,809,568 S555T possibly damaging Het
Other mutations in Tom1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Tom1l1 APN 11 90674740 missense probably damaging 1.00
IGL01995:Tom1l1 APN 11 90649861 missense probably damaging 0.96
R0057:Tom1l1 UTSW 11 90685149 splice site probably benign
R1557:Tom1l1 UTSW 11 90656384 missense possibly damaging 0.92
R1614:Tom1l1 UTSW 11 90683254 missense probably damaging 1.00
R1616:Tom1l1 UTSW 11 90656351 missense possibly damaging 0.92
R2165:Tom1l1 UTSW 11 90649895 splice site probably benign
R2517:Tom1l1 UTSW 11 90671125 missense possibly damaging 0.66
R3745:Tom1l1 UTSW 11 90657741 missense probably benign 0.01
R4614:Tom1l1 UTSW 11 90671126 missense probably damaging 1.00
R4694:Tom1l1 UTSW 11 90646849 missense possibly damaging 0.86
R4755:Tom1l1 UTSW 11 90685116 missense probably damaging 1.00
R5397:Tom1l1 UTSW 11 90661774 missense probably benign 0.02
R6733:Tom1l1 UTSW 11 90685060 critical splice donor site probably null
R6911:Tom1l1 UTSW 11 90644161 intron probably null
R7103:Tom1l1 UTSW 11 90671081 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGAGCATCTCTCGTACTTTGG -3'
(R):5'- CACTGGCGAATGTAGACTGG -3'

Sequencing Primer
(F):5'- CTCGTACTTTGGAGAGCAGGAGC -3'
(R):5'- TTTTAAAGAGCATCCATCCCTAGC -3'
Posted On2018-03-15