Incidental Mutation 'R6294:Ryr2'
ID 508626
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission 044406-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6294 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 11567988-12121831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 11894382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 185 (S185R)
Ref Sequence ENSEMBL: ENSMUSP00000127991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156] [ENSMUST00000220597]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000021750
AA Change: S185R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: S185R

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170156
AA Change: S185R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: S185R

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220597
AA Change: S178R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.2762 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,631,440 (GRCm39) H579L probably benign Het
Aldh2 G A 5: 121,710,879 (GRCm39) Q8* probably null Het
Ankdd1a G T 9: 65,427,446 (GRCm39) H10Q probably benign Het
Arpp21 A G 9: 111,956,520 (GRCm39) F453L probably damaging Het
Birc6 C A 17: 74,996,252 (GRCm39) D4461E probably benign Het
Cacna1b A T 2: 24,609,069 (GRCm39) S411T possibly damaging Het
Camk2g A G 14: 20,815,017 (GRCm39) I203T probably damaging Het
Cat A T 2: 103,290,640 (GRCm39) C425S probably benign Het
Ccdc34 A G 2: 109,848,496 (GRCm39) D95G probably benign Het
Clca4b T C 3: 144,630,946 (GRCm39) S305G probably null Het
Cul7 T C 17: 46,974,074 (GRCm39) I1453T probably benign Het
Dlg1 T A 16: 31,656,942 (GRCm39) I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 (GRCm39) K561T probably benign Het
Erbin T C 13: 103,993,564 (GRCm39) T359A probably benign Het
Far2 T A 6: 148,058,980 (GRCm39) L222Q probably damaging Het
Fbxw17 A G 13: 50,577,839 (GRCm39) E114G probably benign Het
Fryl A T 5: 73,349,102 (GRCm39) probably benign Het
Ggn A G 7: 28,873,273 (GRCm39) D666G possibly damaging Het
Hal G A 10: 93,350,005 (GRCm39) probably null Het
Htt A G 5: 34,979,170 (GRCm39) D851G probably benign Het
Ighv14-2 A T 12: 113,958,218 (GRCm39) D74E probably benign Het
Igkv5-43 G A 6: 69,800,426 (GRCm39) S87L probably damaging Het
Klhl29 A T 12: 5,133,995 (GRCm39) F720I probably damaging Het
Klk1b8 T A 7: 43,602,196 (GRCm39) Y43N probably damaging Het
Krtap20-1 T A 16: 88,880,989 (GRCm39) Y7N unknown Het
Lama4 T A 10: 38,951,466 (GRCm39) F1070L probably damaging Het
Map4 A G 9: 109,831,814 (GRCm39) E98G possibly damaging Het
Mbtd1 C T 11: 93,823,058 (GRCm39) H493Y possibly damaging Het
Mki67 A G 7: 135,306,319 (GRCm39) M581T probably benign Het
Mtss2 T A 8: 111,453,960 (GRCm39) N43K possibly damaging Het
Mylk3 T A 8: 86,077,012 (GRCm39) I475F probably damaging Het
Nat14 C T 7: 4,927,073 (GRCm39) R82* probably null Het
Nckap1 T C 2: 80,371,858 (GRCm39) N324S probably benign Het
Nemp1 C T 10: 127,530,391 (GRCm39) T281M possibly damaging Het
Nrg3 A T 14: 38,119,196 (GRCm39) H425Q probably benign Het
Omd T A 13: 49,743,467 (GRCm39) N172K probably damaging Het
Or10c1 T C 17: 37,522,517 (GRCm39) T76A probably benign Het
Or12d12 T A 17: 37,610,444 (GRCm39) T290S probably benign Het
Or4f62 A G 2: 111,986,364 (GRCm39) I23V probably benign Het
Or52a33 A G 7: 103,288,798 (GRCm39) M183T probably damaging Het
Or52r1c A T 7: 102,734,874 (GRCm39) I45F probably benign Het
Or5b123 T C 19: 13,596,730 (GRCm39) V25A probably benign Het
Orc1 T C 4: 108,447,867 (GRCm39) I38T probably benign Het
Oxct1 A G 15: 4,172,304 (GRCm39) T457A possibly damaging Het
Pcdh17 A T 14: 84,715,108 (GRCm39) K924N probably benign Het
Pkhd1l1 A T 15: 44,433,424 (GRCm39) I3435F probably damaging Het
Psg20 C A 7: 18,416,604 (GRCm39) V171F probably damaging Het
Rab11fip2 A T 19: 59,925,531 (GRCm39) S87T probably damaging Het
Rabgap1l T C 1: 160,059,419 (GRCm39) T237A probably benign Het
Rasgrp1 A T 2: 117,122,273 (GRCm39) Y372* probably null Het
Rell1 G T 5: 64,097,048 (GRCm39) probably benign Het
Rps14 A G 18: 60,910,033 (GRCm39) K61E possibly damaging Het
Rtl6 A G 15: 84,441,321 (GRCm39) V25A possibly damaging Het
Slc10a2 C T 8: 5,141,621 (GRCm39) probably null Het
Slc14a1 T A 18: 78,153,273 (GRCm39) probably null Het
Smad2 A T 18: 76,422,233 (GRCm39) N215I probably benign Het
Smchd1 A T 17: 71,677,922 (GRCm39) N1473K probably benign Het
Spag9 A G 11: 93,984,311 (GRCm39) probably null Het
Stk31 A C 6: 49,394,278 (GRCm39) R213S probably benign Het
Tmod4 A T 3: 95,035,617 (GRCm39) Q255L probably benign Het
Tnpo1 T A 13: 99,027,282 (GRCm39) Y3F probably benign Het
Tom1l1 A C 11: 90,552,587 (GRCm39) Y206* probably null Het
Tulp2 A G 7: 45,164,116 (GRCm39) K36E probably damaging Het
Tulp4 C T 17: 6,252,094 (GRCm39) R282C probably damaging Het
Unc5b A T 10: 60,614,110 (GRCm39) N246K possibly damaging Het
Ush2a C G 1: 188,268,567 (GRCm39) S1674R possibly damaging Het
Vmn1r224 T C 17: 20,640,083 (GRCm39) I220T probably benign Het
Vmn1r7 G C 6: 57,001,404 (GRCm39) N285K probably benign Het
Vmn2r83 C T 10: 79,313,688 (GRCm39) P99S probably damaging Het
Zbtb38 A G 9: 96,569,282 (GRCm39) F601L probably benign Het
Zc3h3 A T 15: 75,681,417 (GRCm39) S555T possibly damaging Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,848,978 (GRCm39) splice site probably benign
IGL00757:Ryr2 APN 13 11,633,490 (GRCm39) splice site probably null
IGL00838:Ryr2 APN 13 11,583,389 (GRCm39) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,600,364 (GRCm39) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,750,388 (GRCm39) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,718,430 (GRCm39) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,653,371 (GRCm39) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,602,125 (GRCm39) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,571,571 (GRCm39) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,606,238 (GRCm39) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,756,922 (GRCm39) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,814,723 (GRCm39) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,866,090 (GRCm39) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,736,676 (GRCm39) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,736,647 (GRCm39) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,616,644 (GRCm39) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,606,202 (GRCm39) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,609,854 (GRCm39) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,707,563 (GRCm39) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,600,366 (GRCm39) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,616,728 (GRCm39) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,610,311 (GRCm39) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,569,436 (GRCm39) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,611,998 (GRCm39) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,762,450 (GRCm39) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,587,143 (GRCm39) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,807,648 (GRCm39) nonsense probably null
IGL02086:Ryr2 APN 13 11,750,442 (GRCm39) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,774,645 (GRCm39) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,752,759 (GRCm39) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,756,755 (GRCm39) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,745,274 (GRCm39) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,762,544 (GRCm39) splice site probably benign
IGL02369:Ryr2 APN 13 11,634,382 (GRCm39) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,737,607 (GRCm39) splice site probably benign
IGL02400:Ryr2 APN 13 11,620,130 (GRCm39) splice site probably benign
IGL02423:Ryr2 APN 13 11,760,084 (GRCm39) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,760,560 (GRCm39) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,720,585 (GRCm39) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,569,397 (GRCm39) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,620,075 (GRCm39) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,753,206 (GRCm39) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,670,563 (GRCm39) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,610,076 (GRCm39) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,722,679 (GRCm39) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,933,205 (GRCm39) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,606,155 (GRCm39) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,774,721 (GRCm39) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,699,365 (GRCm39) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,658,788 (GRCm39) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,650,468 (GRCm39) splice site probably benign
IGL03152:Ryr2 APN 13 11,868,036 (GRCm39) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,756,909 (GRCm39) nonsense probably null
IGL03180:Ryr2 APN 13 11,583,449 (GRCm39) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,739,273 (GRCm39) splice site probably benign
IGL03390:Ryr2 APN 13 11,787,302 (GRCm39) missense probably benign
IGL03410:Ryr2 APN 13 11,603,033 (GRCm39) missense probably damaging 0.99
Arruda UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
Arruda2 UTSW 13 11,894,382 (GRCm39) missense probably damaging 1.00
Arruda3 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
barricuda UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB006:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB016:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,732,027 (GRCm39) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,680,848 (GRCm39) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,776,192 (GRCm39) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,722,682 (GRCm39) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,609,641 (GRCm39) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,570,334 (GRCm39) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,839,265 (GRCm39) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,680,805 (GRCm39) missense probably benign
R0018:Ryr2 UTSW 13 11,610,109 (GRCm39) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,683,924 (GRCm39) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,583,361 (GRCm39) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,724,807 (GRCm39) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,729,434 (GRCm39) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,691,137 (GRCm39) splice site probably benign
R0226:Ryr2 UTSW 13 11,787,442 (GRCm39) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,731,863 (GRCm39) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,683,725 (GRCm39) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,720,570 (GRCm39) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,848,981 (GRCm39) splice site probably benign
R0558:Ryr2 UTSW 13 11,814,747 (GRCm39) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,653,329 (GRCm39) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,746,555 (GRCm39) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,650,445 (GRCm39) missense probably null
R0601:Ryr2 UTSW 13 11,720,519 (GRCm39) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,637,838 (GRCm39) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,739,219 (GRCm39) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,581,771 (GRCm39) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,753,012 (GRCm39) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,684,855 (GRCm39) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,960,867 (GRCm39) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,674,999 (GRCm39) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,897,929 (GRCm39) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,702,765 (GRCm39) splice site probably benign
R1400:Ryr2 UTSW 13 11,609,962 (GRCm39) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,729,389 (GRCm39) splice site probably benign
R1443:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,753,035 (GRCm39) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,741,908 (GRCm39) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,616,727 (GRCm39) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,569,478 (GRCm39) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,569,435 (GRCm39) nonsense probably null
R1551:Ryr2 UTSW 13 11,800,029 (GRCm39) critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11,774,563 (GRCm39) missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11,809,449 (GRCm39) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,733,368 (GRCm39) nonsense probably null
R1686:Ryr2 UTSW 13 11,618,665 (GRCm39) splice site probably benign
R1696:Ryr2 UTSW 13 11,746,543 (GRCm39) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,602,328 (GRCm39) splice site probably null
R1728:Ryr2 UTSW 13 11,602,308 (GRCm39) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,805,153 (GRCm39) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,715,257 (GRCm39) nonsense probably null
R1801:Ryr2 UTSW 13 11,610,167 (GRCm39) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,575,472 (GRCm39) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,602,202 (GRCm39) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,784,764 (GRCm39) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,746,586 (GRCm39) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,676,961 (GRCm39) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,753,242 (GRCm39) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,673,844 (GRCm39) nonsense probably null
R1897:Ryr2 UTSW 13 11,765,818 (GRCm39) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,606,222 (GRCm39) missense probably benign
R1909:Ryr2 UTSW 13 11,715,235 (GRCm39) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,571,584 (GRCm39) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,746,609 (GRCm39) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,695,966 (GRCm39) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,600,288 (GRCm39) splice site probably null
R2018:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,610,622 (GRCm39) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,680,764 (GRCm39) splice site probably null
R2088:Ryr2 UTSW 13 11,677,115 (GRCm39) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,727,081 (GRCm39) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,575,493 (GRCm39) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,592,759 (GRCm39) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,720,679 (GRCm39) nonsense probably null
R2207:Ryr2 UTSW 13 11,825,823 (GRCm39) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,677,146 (GRCm39) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,753,102 (GRCm39) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,753,128 (GRCm39) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,606,123 (GRCm39) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,816,734 (GRCm39) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,787,466 (GRCm39) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,603,045 (GRCm39) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,753,095 (GRCm39) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,787,313 (GRCm39) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,933,300 (GRCm39) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,707,568 (GRCm39) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,794,153 (GRCm39) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,602,323 (GRCm39) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,752,759 (GRCm39) missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11,765,611 (GRCm39) missense probably benign 0.20
R4355:Ryr2 UTSW 13 11,664,698 (GRCm39) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,620,119 (GRCm39) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,731,952 (GRCm39) nonsense probably null
R4430:Ryr2 UTSW 13 11,750,413 (GRCm39) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,121,301 (GRCm39) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,764,395 (GRCm39) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,765,571 (GRCm39) splice site probably null
R4668:Ryr2 UTSW 13 11,608,003 (GRCm39) missense probably benign
R4677:Ryr2 UTSW 13 11,721,553 (GRCm39) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,839,255 (GRCm39) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,610,119 (GRCm39) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,707,532 (GRCm39) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,731,884 (GRCm39) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,752,639 (GRCm39) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,671,933 (GRCm39) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,731,983 (GRCm39) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,670,584 (GRCm39) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,760,638 (GRCm39) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,683,706 (GRCm39) missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11,767,104 (GRCm39) missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,724,849 (GRCm39) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,960,831 (GRCm39) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,756,897 (GRCm39) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,799,966 (GRCm39) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,610,192 (GRCm39) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,602,140 (GRCm39) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,650,422 (GRCm39) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,715,240 (GRCm39) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,727,129 (GRCm39) nonsense probably null
R5135:Ryr2 UTSW 13 11,677,016 (GRCm39) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,675,175 (GRCm39) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,767,207 (GRCm39) missense probably benign
R5187:Ryr2 UTSW 13 11,787,338 (GRCm39) missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11,653,316 (GRCm39) critical splice donor site probably null
R5262:Ryr2 UTSW 13 11,787,323 (GRCm39) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,705,249 (GRCm39) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,571,544 (GRCm39) missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,720,542 (GRCm39) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,720,587 (GRCm39) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,702,795 (GRCm39) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,723,088 (GRCm39) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,616,691 (GRCm39) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,610,468 (GRCm39) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,774,722 (GRCm39) missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11,784,848 (GRCm39) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,575,460 (GRCm39) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,599,040 (GRCm39) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,805,218 (GRCm39) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,702,788 (GRCm39) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,675,008 (GRCm39) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,741,839 (GRCm39) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,677,124 (GRCm39) nonsense probably null
R5974:Ryr2 UTSW 13 11,729,397 (GRCm39) splice site probably null
R6104:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,807,575 (GRCm39) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,683,903 (GRCm39) missense probably benign
R6208:Ryr2 UTSW 13 11,910,106 (GRCm39) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,848,964 (GRCm39) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,674,993 (GRCm39) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6300:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,776,282 (GRCm39) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,677,269 (GRCm39) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,848,893 (GRCm39) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,683,707 (GRCm39) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,724,951 (GRCm39) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,610,529 (GRCm39) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,753,348 (GRCm39) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,701,852 (GRCm39) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,741,816 (GRCm39) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,844,540 (GRCm39) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,842,445 (GRCm39) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,581,834 (GRCm39) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,816,129 (GRCm39) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,669,266 (GRCm39) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,727,052 (GRCm39) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,809,491 (GRCm39) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,839,286 (GRCm39) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,664,662 (GRCm39) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,684,873 (GRCm39) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,683,697 (GRCm39) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,655,213 (GRCm39) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,825,794 (GRCm39) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,816,063 (GRCm39) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,701,864 (GRCm39) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,774,643 (GRCm39) missense probably benign
R7189:Ryr2 UTSW 13 11,898,009 (GRCm39) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,680,799 (GRCm39) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,612,032 (GRCm39) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,753,080 (GRCm39) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,760,517 (GRCm39) missense probably benign
R7365:Ryr2 UTSW 13 11,655,161 (GRCm39) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,799,997 (GRCm39) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,750,506 (GRCm39) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,571,634 (GRCm39) splice site probably null
R7425:Ryr2 UTSW 13 11,720,530 (GRCm39) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,570,349 (GRCm39) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,767,168 (GRCm39) missense probably benign
R7460:Ryr2 UTSW 13 11,720,596 (GRCm39) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,609,762 (GRCm39) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,653,317 (GRCm39) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,752,871 (GRCm39) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,575,539 (GRCm39) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,776,213 (GRCm39) missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11,776,201 (GRCm39) missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11,705,219 (GRCm39) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,745,229 (GRCm39) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,765,897 (GRCm39) missense probably benign
R7797:Ryr2 UTSW 13 11,816,066 (GRCm39) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,842,493 (GRCm39) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,721,509 (GRCm39) nonsense probably null
R7872:Ryr2 UTSW 13 11,610,610 (GRCm39) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,807,634 (GRCm39) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
R7952:Ryr2 UTSW 13 11,661,313 (GRCm39) splice site probably null
R8008:Ryr2 UTSW 13 11,671,980 (GRCm39) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,603,026 (GRCm39) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,960,881 (GRCm39) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,618,584 (GRCm39) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,842,439 (GRCm39) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,610,392 (GRCm39) nonsense probably null
R8351:Ryr2 UTSW 13 11,814,718 (GRCm39) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,683,821 (GRCm39) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,699,364 (GRCm39) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,673,894 (GRCm39) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,592,664 (GRCm39) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,575,479 (GRCm39) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,702,875 (GRCm39) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,701,833 (GRCm39) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,683,855 (GRCm39) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,750,509 (GRCm39) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,572,934 (GRCm39) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,799,990 (GRCm39) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,814,768 (GRCm39) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,609,924 (GRCm39) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,609,672 (GRCm39) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,752,989 (GRCm39) nonsense probably null
R9056:Ryr2 UTSW 13 11,610,817 (GRCm39) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,616,724 (GRCm39) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,618,741 (GRCm39) intron probably benign
R9116:Ryr2 UTSW 13 11,587,185 (GRCm39) missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11,669,292 (GRCm39) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,900,424 (GRCm39) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,610,772 (GRCm39) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,765,854 (GRCm39) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,721,578 (GRCm39) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,695,973 (GRCm39) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,809,459 (GRCm39) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,787,463 (GRCm39) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,752,680 (GRCm39) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,571,490 (GRCm39) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,602,101 (GRCm39) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,760,104 (GRCm39) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,737,646 (GRCm39) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,701,935 (GRCm39) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,609,785 (GRCm39) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,707,599 (GRCm39) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,718,387 (GRCm39) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,658,689 (GRCm39) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,613,497 (GRCm39) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,809,435 (GRCm39) nonsense probably null
Z1177:Ryr2 UTSW 13 11,765,759 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGAAGCCTGCTCAAACAGAC -3'
(R):5'- TTCTGAACGTCCCTTGAGTGG -3'

Sequencing Primer
(F):5'- TGCTCAAACAGACCCAGGGAG -3'
(R):5'- GTCCCTTGAGTGGCGTCATC -3'
Posted On 2018-03-15