Incidental Mutation 'R5911:Fgfr1'
ID508653
Institutional Source Beutler Lab
Gene Symbol Fgfr1
Ensembl Gene ENSMUSG00000031565
Gene Namefibroblast growth factor receptor 1
SynonymsEask, Hspy, Fgfr-1, Flt-2
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5911 (G1)
Quality Score22
Status Validated
Chromosome8
Chromosomal Location25513654-25575718 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 25519309 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084027] [ENSMUST00000117179] [ENSMUST00000119398] [ENSMUST00000124228] [ENSMUST00000155564] [ENSMUST00000178276] [ENSMUST00000179592]
Predicted Effect probably benign
Transcript: ENSMUST00000084027
SMART Domains Protein: ENSMUSP00000081041
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 169 237 4.09e-9 SMART
IGc2 268 348 1.26e-9 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
TyrKc 478 754 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117179
SMART Domains Protein: ENSMUSP00000113909
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 167 235 4.09e-9 SMART
IGc2 266 346 1.26e-9 SMART
transmembrane domain 373 395 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
TyrKc 476 752 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119398
SMART Domains Protein: ENSMUSP00000113855
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 80 148 4.09e-9 SMART
IGc2 179 259 1.26e-9 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124228
SMART Domains Protein: ENSMUSP00000116564
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 104 5.75e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148322
Predicted Effect probably benign
Transcript: ENSMUST00000155564
SMART Domains Protein: ENSMUSP00000117884
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:2CKN|A 25 51 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000178276
SMART Domains Protein: ENSMUSP00000137515
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179592
SMART Domains Protein: ENSMUSP00000136640
Gene: ENSMUSG00000031565

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 59 121 2.94e-10 SMART
low complexity region 137 151 N/A INTRINSIC
IGc2 180 248 4.09e-9 SMART
IGc2 279 359 1.26e-9 SMART
transmembrane domain 386 408 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
TyrKc 489 765 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210778
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die around gastrulation and show defective patterning of axial structures. Hypomorphic and selectively ablated mutations exhibit a wide range of abnormalities affecting diverse structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Fgfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fgfr1 APN 8 25562223 nonsense probably null
IGL01537:Fgfr1 APN 8 25555579 missense probably damaging 1.00
IGL01643:Fgfr1 APN 8 25566735 missense probably benign 0.01
IGL01875:Fgfr1 APN 8 25573553 missense possibly damaging 0.81
IGL02002:Fgfr1 APN 8 25555711 missense probably damaging 1.00
IGL02698:Fgfr1 APN 8 25573608 nonsense probably null
IGL02822:Fgfr1 APN 8 25557802 missense probably benign 0.13
IGL03292:Fgfr1 APN 8 25557755 missense possibly damaging 0.50
R0003:Fgfr1 UTSW 8 25568198 missense possibly damaging 0.80
R0723:Fgfr1 UTSW 8 25557768 missense probably damaging 0.99
R0730:Fgfr1 UTSW 8 25555744 missense probably benign
R1144:Fgfr1 UTSW 8 25558143 missense probably damaging 1.00
R1455:Fgfr1 UTSW 8 25562276 missense possibly damaging 0.81
R1591:Fgfr1 UTSW 8 25572720 missense probably damaging 1.00
R1754:Fgfr1 UTSW 8 25570210 missense probably damaging 1.00
R2045:Fgfr1 UTSW 8 25558215 missense probably benign 0.04
R2139:Fgfr1 UTSW 8 25570866 missense probably damaging 1.00
R2314:Fgfr1 UTSW 8 25570893 missense probably damaging 1.00
R2517:Fgfr1 UTSW 8 25563446 missense probably damaging 1.00
R2982:Fgfr1 UTSW 8 25558211 missense probably benign 0.04
R3796:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R3797:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R3799:Fgfr1 UTSW 8 25572437 missense probably damaging 1.00
R4323:Fgfr1 UTSW 8 25573899 missense probably benign 0.37
R4594:Fgfr1 UTSW 8 25573836 missense probably damaging 0.99
R4614:Fgfr1 UTSW 8 25557797 missense probably benign 0.25
R4696:Fgfr1 UTSW 8 25563488 missense probably damaging 0.99
R4916:Fgfr1 UTSW 8 25563526 critical splice donor site probably null
R4966:Fgfr1 UTSW 8 25572445 nonsense probably null
R5094:Fgfr1 UTSW 8 25570165 missense probably damaging 1.00
R5730:Fgfr1 UTSW 8 25573811 missense probably damaging 1.00
R7310:Fgfr1 UTSW 8 25562315 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTTTCTCAGGTCCCAGGG -3'
(R):5'- AGTAGGGAACACACAGCTTCC -3'

Sequencing Primer
(F):5'- AGCCGTGCTGCAGTCAATG -3'
(R):5'- TTCTCCTGGGCCAAGAGG -3'
Posted On2018-03-16