Incidental Mutation 'R6144:Top3b'
ID508657
Institutional Source Beutler Lab
Gene Symbol Top3b
Ensembl Gene ENSMUSG00000022779
Gene Nametopoisomerase (DNA) III beta
SynonymsTopo III beta
MMRRC Submission 044291-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R6144 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location16870736-16892990 bp(+) (GRCm38)
Type of Mutationunclassified (154 bp from exon)
DNA Base Change (assembly) A to G at 16879141 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023465] [ENSMUST00000144513] [ENSMUST00000231812] [ENSMUST00000232017] [ENSMUST00000232080] [ENSMUST00000232200] [ENSMUST00000232231] [ENSMUST00000232547] [ENSMUST00000232581]
Predicted Effect probably benign
Transcript: ENSMUST00000023465
SMART Domains Protein: ENSMUSP00000023465
Gene: ENSMUSG00000022779

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144513
SMART Domains Protein: ENSMUSP00000121645
Gene: ENSMUSG00000022779

DomainStartEndE-ValueType
SCOP:d1gkub3 1 55 1e-10 SMART
Blast:TOPRIM 3 55 5e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231576
Predicted Effect probably benign
Transcript: ENSMUST00000231812
Predicted Effect probably benign
Transcript: ENSMUST00000232017
Predicted Effect probably benign
Transcript: ENSMUST00000232080
Predicted Effect probably benign
Transcript: ENSMUST00000232117
Predicted Effect probably null
Transcript: ENSMUST00000232200
Predicted Effect probably benign
Transcript: ENSMUST00000232231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232531
Predicted Effect probably null
Transcript: ENSMUST00000232547
Predicted Effect probably benign
Transcript: ENSMUST00000232581
Meta Mutation Damage Score 0.6448 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination, cellular aging and maintenance of genome stability. Low expression of this gene may be related to higher survival rates in breast cancer patients. This gene has a pseudogene on chromosome 22. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice develop to maturity but die prematurely showing enlargement of lymphatic organs and glomerulonephritis. Intercrossing of mutant mice progressively results in infertility that is correlated to increased aneuploidy in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3300002I08Rik A T 2: 150,344,644 D40E possibly damaging Het
4921517D22Rik C T 13: 59,689,533 R246H probably damaging Het
Agbl1 A G 7: 76,420,084 T203A probably benign Het
Alms1 T A 6: 85,623,074 D2096E probably damaging Het
Ankrd53 T C 6: 83,762,657 probably benign Het
Arap3 C A 18: 37,985,433 G814C probably damaging Het
Armc9 T G 1: 86,244,579 I5S probably benign Het
Catsperg1 T C 7: 29,210,695 T74A probably damaging Het
Ccpg1os C A 9: 72,979,988 C79F probably damaging Het
Cdca7l T A 12: 117,873,711 probably null Het
Cfhr2 T A 1: 139,805,415 probably benign Het
Chpt1 A G 10: 88,453,093 probably benign Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Col7a1 C T 9: 108,974,080 R2149C unknown Het
Cpa4 T C 6: 30,585,083 S289P probably damaging Het
Cpsf3 G A 12: 21,306,886 probably null Het
Creb3l1 T C 2: 91,992,005 H212R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c29 A G 19: 39,321,609 D254G possibly damaging Het
Ddx58 T C 4: 40,229,551 I78V probably benign Het
Dennd1b A G 1: 139,081,255 H232R probably damaging Het
Dhx29 T C 13: 112,964,571 L1216P probably damaging Het
Dsg1b T C 18: 20,396,419 I307T possibly damaging Het
Ep300 A G 15: 81,601,234 S141G unknown Het
Evl A C 12: 108,653,031 K101T probably damaging Het
Exph5 G A 9: 53,373,028 G470R probably benign Het
Fam126a T C 5: 23,966,369 S352G possibly damaging Het
Flg A T 3: 93,283,208 probably benign Het
Gm45704 T A 8: 72,784,292 Het
Grm1 T C 10: 11,079,896 M215V probably benign Het
Hadha T C 5: 30,140,996 D210G probably benign Het
Hmcn1 T C 1: 150,722,424 Y1709C probably damaging Het
Hrc A T 7: 45,336,733 H436L possibly damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Itgb7 C A 15: 102,223,482 R222L probably benign Het
Khnyn T C 14: 55,887,839 V485A probably damaging Het
Kifc5b T C 17: 26,921,852 V100A probably benign Het
Lsm10 T C 4: 126,098,001 M50T probably damaging Het
Map3k6 T G 4: 133,245,675 W382G probably damaging Het
Mink1 T A 11: 70,610,652 F922I possibly damaging Het
Mpp5 T C 12: 78,824,789 V381A possibly damaging Het
Mrap2 T C 9: 87,175,818 V53A probably damaging Het
Mrps7 C A 11: 115,604,174 A5E probably benign Het
Muc4 A G 16: 32,766,924 N2713S possibly damaging Het
Nckipsd T C 9: 108,812,386 S249P probably damaging Het
Neil3 T C 8: 53,599,412 T384A probably benign Het
Noc3l A T 19: 38,798,955 I504K probably damaging Het
Nudt13 A G 14: 20,307,771 N107S probably benign Het
Olfr134 T A 17: 38,175,225 L47H probably damaging Het
Olfr368 T A 2: 37,332,113 M122K probably damaging Het
Olfr747 C A 14: 50,680,935 R233L probably benign Het
Otub1 G T 19: 7,199,153 Y205* probably null Het
Plpp7 T A 2: 32,096,088 S93T probably damaging Het
Pxk T G 14: 8,138,011 Y188D probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpap1 A T 2: 119,772,647 C602* probably null Het
Sbds T C 5: 130,246,344 K248E probably benign Het
Serpina10 A T 12: 103,628,833 N42K probably benign Het
Slc7a8 A G 14: 54,729,340 L368P probably damaging Het
Srrm1 T C 4: 135,337,873 probably benign Het
Sun2 C T 15: 79,730,332 V288I probably benign Het
Tas2r107 C A 6: 131,660,003 A28S possibly damaging Het
Tbc1d9b T C 11: 50,146,328 I268T probably benign Het
Tjp2 A G 19: 24,120,073 F495L probably damaging Het
Top2b T C 14: 16,423,740 L1434P possibly damaging Het
Trdv2-2 A T 14: 53,961,304 E17V possibly damaging Het
Ttc6 T A 12: 57,673,100 L819Q possibly damaging Het
Txlnb A G 10: 17,843,166 T582A probably benign Het
Zfp788 T C 7: 41,649,769 S558P probably damaging Het
Other mutations in Top3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Top3b APN 16 16887622 missense probably damaging 0.97
IGL01512:Top3b APN 16 16891422 missense possibly damaging 0.74
IGL01552:Top3b APN 16 16887823 splice site probably benign
IGL01738:Top3b APN 16 16880604 missense probably benign 0.04
IGL02090:Top3b APN 16 16891470 missense possibly damaging 0.81
R0143:Top3b UTSW 16 16883525 missense probably damaging 0.97
R0883:Top3b UTSW 16 16879437 splice site probably benign
R1386:Top3b UTSW 16 16880629 missense probably benign 0.29
R1440:Top3b UTSW 16 16892777 nonsense probably null
R1958:Top3b UTSW 16 16884302 missense possibly damaging 0.52
R1970:Top3b UTSW 16 16883519 missense probably damaging 1.00
R4211:Top3b UTSW 16 16882532 unclassified probably null
R4292:Top3b UTSW 16 16883519 missense probably damaging 1.00
R4307:Top3b UTSW 16 16889617 splice site probably benign
R4832:Top3b UTSW 16 16890662 nonsense probably null
R5047:Top3b UTSW 16 16891418 missense probably benign 0.00
R5364:Top3b UTSW 16 16886970 missense probably benign 0.00
R5590:Top3b UTSW 16 16891577 intron probably benign
R5604:Top3b UTSW 16 16889535 nonsense probably null
R5719:Top3b UTSW 16 16885836 missense probably damaging 1.00
R5969:Top3b UTSW 16 16883565 critical splice donor site probably null
R6018:Top3b UTSW 16 16892892 missense probably damaging 1.00
R6155:Top3b UTSW 16 16891509 missense probably damaging 1.00
R6341:Top3b UTSW 16 16879071 missense probably damaging 0.98
R6700:Top3b UTSW 16 16892669 missense possibly damaging 0.48
R7417:Top3b UTSW 16 16877850 start gained probably benign
X0011:Top3b UTSW 16 16890189 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCACACAAAGGGCTGAATGGG -3'
(R):5'- AGCTTGGCTGAAGAGCTCTG -3'

Sequencing Primer
(F):5'- GGCATGTTCAGTGCACAAGTACAC -3'
(R):5'- TGAAGAGCTCTGCAGGATCCAC -3'
Posted On2018-03-16