Incidental Mutation 'R5906:Gm13441'
List |< first << previous [record 77 of 217] next >> last >|
ID508684
Institutional Source Beutler Lab
Gene Symbol Gm13441
Ensembl Gene ENSMUSG00000086356
Gene Namepredicted gene 13441
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5906 (G1)
Quality Score40
Status Validated
Chromosome2
Chromosomal Location31886934-31892417 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) G to C at 31887499 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
Predicted Effect silent
Transcript: ENSMUST00000028187
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000138325
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140104
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
9130023H24Rik G A 7: 128,236,492 P310S probably benign Het
Abcc10 G T 17: 46,316,559 H652Q probably benign Het
Actl6b A G 5: 137,567,329 I396V possibly damaging Het
Acvr1b T C 15: 101,193,891 probably benign Het
Adamts18 A T 8: 113,709,619 H989Q probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Angptl3 A G 4: 99,037,567 T377A probably benign Het
Ankmy2 G A 12: 36,176,633 V109M probably damaging Het
Anpep G A 7: 79,833,675 A689V probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cacna1d C T 14: 30,096,960 V1213I probably damaging Het
Capn1 A G 19: 6,011,421 F156L possibly damaging Het
Catsperb C A 12: 101,510,462 F408L probably damaging Het
Ccdc146 A T 5: 21,301,352 L697Q possibly damaging Het
Cd163l1 T A 7: 140,228,799 D874E probably damaging Het
Cdc37l1 T A 19: 29,011,986 V281E probably benign Het
Chia1 A T 3: 106,131,988 T465S probably benign Het
Cidec A T 6: 113,428,321 probably null Het
Clcnkb T C 4: 141,412,299 T131A probably benign Het
Clec5a T A 6: 40,581,859 M98L probably benign Het
Cnga1 A T 5: 72,610,858 F162I probably benign Het
Cyp27b1 A T 10: 127,048,398 I40F probably damaging Het
Edrf1 A G 7: 133,663,415 S1027G probably benign Het
Entpd1 C A 19: 40,738,839 A448E probably damaging Het
Espl1 T C 15: 102,296,851 probably null Het
Etfdh T C 3: 79,604,115 I520V probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gabra4 G A 5: 71,623,910 P386L probably benign Het
Gckr G T 5: 31,306,578 V281L probably damaging Het
Gfy T C 7: 45,177,743 T310A probably benign Het
Gjc2 C A 11: 59,176,841 V272L probably benign Het
H2-DMb2 T A 17: 34,148,608 M1K probably null Het
Hipk3 T C 2: 104,471,808 Y13C probably damaging Het
Kcnt1 A T 2: 25,894,524 probably benign Het
Kcnt1 T C 2: 25,898,401 F336S probably damaging Het
Klhdc7b A G 15: 89,387,156 D747G probably benign Het
Krt78 T A 15: 101,948,595 E359V probably damaging Het
Mast4 T C 13: 102,735,744 D2195G probably benign Het
Matk C T 10: 81,260,919 L188F probably damaging Het
Mcoln2 T C 3: 146,183,741 I399T probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nap1l1 A T 10: 111,491,030 K151* probably null Het
Ncbp3 T A 11: 73,073,501 S426T probably benign Het
Nisch T A 14: 31,172,028 probably null Het
Olfr145 A G 9: 37,897,878 H158R probably damaging Het
Olfr1467 T C 19: 13,365,005 C126R probably damaging Het
Olfr160 A G 9: 37,711,805 I158T probably benign Het
Olfr725 T C 14: 50,034,849 T185A probably benign Het
Peg3 T C 7: 6,717,855 D17G probably damaging Het
Pkd1 G A 17: 24,572,920 V1194M probably benign Het
Pkd1l2 A T 8: 117,029,648 I1615N probably damaging Het
Pkd2 A T 5: 104,477,179 probably null Het
Pkp4 T A 2: 59,305,076 N97K possibly damaging Het
Prrx2 C T 2: 30,879,510 R78C probably damaging Het
Pycr1 T A 11: 120,642,162 I91F probably damaging Het
Rap1a T C 3: 105,737,765 N87S possibly damaging Het
Sbk2 T G 7: 4,957,628 Y181S probably damaging Het
Sec16a A T 2: 26,438,831 H1057Q possibly damaging Het
Sfswap G A 5: 129,542,043 E486K probably benign Het
Shank3 T C 15: 89,548,916 V1213A probably damaging Het
Slfn5 T A 11: 82,957,276 I329K probably benign Het
Slit1 T A 19: 41,606,374 N1186Y probably damaging Het
Ssbp3 A G 4: 107,009,821 probably benign Het
Steap3 T A 1: 120,244,001 I125F probably damaging Het
Synpr C A 14: 13,608,788 probably benign Het
Tom1 T C 8: 75,050,258 L69P probably damaging Het
Traf3ip3 T A 1: 193,198,006 D5V possibly damaging Het
Vmn1r29 G A 6: 58,307,751 S152N probably benign Het
Vmn1r68 T C 7: 10,527,623 I183V probably benign Het
Wdr17 C G 8: 54,639,468 V1094L probably benign Het
Wdr95 A G 5: 149,564,227 I109V possibly damaging Het
Zfp39 T C 11: 58,902,891 D7G probably benign Het
Zfp512 A T 5: 31,480,064 Q443L probably damaging Het
Zfp974 T A 7: 27,910,805 K498N possibly damaging Het
Predicted Primers PCR Primer
(F):5'- AGGTTCACAGTTCCCGAGTC -3'
(R):5'- TAACAGAGGTGGGGTACTGCAC -3'

Sequencing Primer
(F):5'- ACCGCAGCGTAGAGTGGATC -3'
(R):5'- TGCCACCAGGTGCTGTCATC -3'
Posted On2018-03-29