Incidental Mutation 'R6296:Ptpn23'
ID508772
Institutional Source Beutler Lab
Gene Symbol Ptpn23
Ensembl Gene ENSMUSG00000036057
Gene Nameprotein tyrosine phosphatase, non-receptor type 23
SynonymsPTP-TD14
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6296 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110385082-110408213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110393826 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 54 (N54K)
Ref Sequence ENSEMBL: ENSMUSP00000039580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040021]
PDB Structure
MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040021
AA Change: N54K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057
AA Change: N54K

DomainStartEndE-ValueType
BRO1 8 384 5.94e-159 SMART
Pfam:ALIX_LYPXL_bnd 416 704 1.4e-64 PFAM
low complexity region 715 728 N/A INTRINSIC
low complexity region 774 785 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 905 928 N/A INTRINSIC
internal_repeat_1 929 942 8.2e-5 PROSPERO
internal_repeat_1 943 956 8.2e-5 PROSPERO
low complexity region 977 1018 N/A INTRINSIC
low complexity region 1040 1061 N/A INTRINSIC
low complexity region 1088 1106 N/A INTRINSIC
low complexity region 1128 1160 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
low complexity region 1225 1235 N/A INTRINSIC
PTPc 1246 1510 1.28e-92 SMART
low complexity region 1576 1587 N/A INTRINSIC
low complexity region 1589 1643 N/A INTRINSIC
Blast:PTPc 1644 1673 9e-8 BLAST
low complexity region 1675 1689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199254
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Embryos homozygous for a gene trap allele are significantly growth retarded and fail to reach the E8.5 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
5730559C18Rik C T 1: 136,221,071 probably null Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Adcy5 A G 16: 35,303,710 Y1253C probably damaging Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Adm A G 7: 110,628,354 T26A probably benign Het
Ahnak T G 19: 9,003,305 V651G probably damaging Het
Akr7a5 G A 4: 139,318,221 V358I probably benign Het
Ankar T G 1: 72,643,258 T1383P probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cacna1h G A 17: 25,383,079 R1596C probably damaging Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Cfap54 T C 10: 93,066,846 Y148C probably damaging Het
Coa5 A G 1: 37,428,347 S60P probably damaging Het
Col6a2 T C 10: 76,611,049 N342D probably damaging Het
Cyp2c29 T G 19: 39,330,261 I434S possibly damaging Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dusp16 C A 6: 134,720,493 probably null Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Epn1 G A 7: 5,090,123 A145T probably damaging Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Gm6358 T C 16: 89,141,082 S70P unknown Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hsfy2 T A 1: 56,637,192 H62L probably benign Het
Ighm T C 12: 113,421,567 I258V unknown Het
Igkv13-71-1 G T 6: 69,235,799 noncoding transcript Het
Irx1 A C 13: 71,959,668 S298R probably damaging Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kcnc1 G A 7: 46,435,316 A555T probably benign Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lipo1 T C 19: 33,780,337 D244G probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Macf1 A T 4: 123,432,875 I4943N probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr209 T C 16: 59,361,406 K271E probably benign Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pbx1 T C 1: 168,183,615 D372G possibly damaging Het
Pikfyve T A 1: 65,262,953 S1668T probably damaging Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Plag1 G T 4: 3,904,499 H231N probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rassf9 T A 10: 102,545,753 I332N probably damaging Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rnf214 A G 9: 45,867,821 S389P probably benign Het
Rxfp1 A C 3: 79,667,848 L181R probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Sh3bp4 C A 1: 89,145,489 S686R probably damaging Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stard13 A T 5: 151,062,673 S339R probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tinag T A 9: 76,996,935 E402V possibly damaging Het
Tmem183a T C 1: 134,361,611 D27G probably damaging Het
Tnfrsf13c T C 15: 82,223,902 T56A probably damaging Het
Tnrc18 A C 5: 142,733,576 L1985R unknown Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Ufl1 G T 4: 25,270,572 Q215K probably benign Het
Unkl T C 17: 25,231,865 *232R probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Xkr4 T C 1: 3,216,570 T466A probably benign Het
Zfp451 T A 1: 33,769,817 K988* probably null Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Ptpn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Ptpn23 APN 9 110388106 missense probably benign 0.00
IGL01462:Ptpn23 APN 9 110408107 missense probably benign 0.33
IGL01666:Ptpn23 APN 9 110386545 missense possibly damaging 0.95
IGL01757:Ptpn23 APN 9 110391636 missense probably damaging 1.00
IGL02402:Ptpn23 APN 9 110393713 missense possibly damaging 0.81
IGL02891:Ptpn23 APN 9 110388020 nonsense probably null
peony UTSW 9 110386507 missense probably damaging 0.97
FR4449:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4548:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4737:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4976:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
R0111:Ptpn23 UTSW 9 110385623 missense probably damaging 0.97
R0377:Ptpn23 UTSW 9 110388132 missense possibly damaging 0.73
R0432:Ptpn23 UTSW 9 110389010 critical splice donor site probably null
R0456:Ptpn23 UTSW 9 110389793 splice site probably null
R0457:Ptpn23 UTSW 9 110386293 missense possibly damaging 0.95
R0988:Ptpn23 UTSW 9 110388777 missense probably benign 0.02
R1072:Ptpn23 UTSW 9 110386595 missense probably benign 0.29
R1769:Ptpn23 UTSW 9 110391678 missense possibly damaging 0.89
R1859:Ptpn23 UTSW 9 110388870 missense possibly damaging 0.92
R1891:Ptpn23 UTSW 9 110393800 missense possibly damaging 0.74
R1915:Ptpn23 UTSW 9 110386507 missense probably damaging 0.97
R1954:Ptpn23 UTSW 9 110386325 missense probably damaging 0.99
R2299:Ptpn23 UTSW 9 110392513 missense possibly damaging 0.72
R2431:Ptpn23 UTSW 9 110386279 nonsense probably null
R2445:Ptpn23 UTSW 9 110387632 missense possibly damaging 0.79
R3014:Ptpn23 UTSW 9 110389695 missense probably benign
R3820:Ptpn23 UTSW 9 110389794 unclassified probably benign
R3904:Ptpn23 UTSW 9 110389245 missense probably benign 0.11
R4441:Ptpn23 UTSW 9 110392725 missense probably benign 0.01
R4464:Ptpn23 UTSW 9 110386813 missense probably damaging 1.00
R4709:Ptpn23 UTSW 9 110388856 missense possibly damaging 0.86
R4810:Ptpn23 UTSW 9 110389136 missense possibly damaging 0.93
R4937:Ptpn23 UTSW 9 110392738 missense probably benign 0.09
R5023:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5057:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5065:Ptpn23 UTSW 9 110398188 missense possibly damaging 0.91
R5143:Ptpn23 UTSW 9 110385438 unclassified probably benign
R5370:Ptpn23 UTSW 9 110385701 missense possibly damaging 0.79
R5534:Ptpn23 UTSW 9 110392741 missense possibly damaging 0.95
R5715:Ptpn23 UTSW 9 110387075 missense probably damaging 1.00
R5914:Ptpn23 UTSW 9 110385443 unclassified probably benign
R6122:Ptpn23 UTSW 9 110387825 unclassified probably benign
R6155:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6156:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6755:Ptpn23 UTSW 9 110389787 missense probably damaging 0.98
R7018:Ptpn23 UTSW 9 110385816 missense possibly damaging 0.89
R7126:Ptpn23 UTSW 9 110388744 missense probably benign 0.00
R7181:Ptpn23 UTSW 9 110385257 missense unknown
X0062:Ptpn23 UTSW 9 110387707 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCCAAGTTCACACCTTCTAAG -3'
(R):5'- GTTTCAGATGAAGAACTTCGGATC -3'

Sequencing Primer
(F):5'- AAGTTCTCATCTGCCCAGC -3'
(R):5'- TCAAGCTGGAGCAATGTCTC -3'
Posted On2018-04-02