Incidental Mutation 'R6296:Supt6'
ID508779
Institutional Source Beutler Lab
Gene Symbol Supt6
Ensembl Gene ENSMUSG00000002052
Gene Namesuppressor of Ty 6
SynonymsSPT6, Supt6h, 5131400N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6296 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location78206746-78245987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78226059 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 589 (R589Q)
Ref Sequence ENSEMBL: ENSMUSP00000002121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002121]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002121
AA Change: R589Q

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002121
Gene: ENSMUSG00000002052
AA Change: R589Q

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:SPT6_acidic 37 127 8.8e-19 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 220 250 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
Pfam:HTH_44 305 432 1.3e-28 PFAM
low complexity region 494 509 N/A INTRINSIC
YqgFc 779 894 4.27e-21 SMART
Pfam:HHH_7 935 1038 3.1e-55 PFAM
Pfam:HHH_3 966 1036 5.2e-10 PFAM
Pfam:DLD 1051 1159 6.8e-39 PFAM
S1 1221 1282 2.8e-3 SMART
SH2 1332 1421 4.12e-11 SMART
low complexity region 1441 1454 N/A INTRINSIC
Blast:SH2 1455 1517 9e-19 BLAST
low complexity region 1586 1599 N/A INTRINSIC
low complexity region 1639 1664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108314
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality during pre-implantation development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
5730559C18Rik C T 1: 136,221,071 probably null Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Adcy5 A G 16: 35,303,710 Y1253C probably damaging Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Adm A G 7: 110,628,354 T26A probably benign Het
Ahnak T G 19: 9,003,305 V651G probably damaging Het
Akr7a5 G A 4: 139,318,221 V358I probably benign Het
Ankar T G 1: 72,643,258 T1383P probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cacna1h G A 17: 25,383,079 R1596C probably damaging Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Cfap54 T C 10: 93,066,846 Y148C probably damaging Het
Coa5 A G 1: 37,428,347 S60P probably damaging Het
Col6a2 T C 10: 76,611,049 N342D probably damaging Het
Cyp2c29 T G 19: 39,330,261 I434S possibly damaging Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dusp16 C A 6: 134,720,493 probably null Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Epn1 G A 7: 5,090,123 A145T probably damaging Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Gm6358 T C 16: 89,141,082 S70P unknown Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hsfy2 T A 1: 56,637,192 H62L probably benign Het
Ighm T C 12: 113,421,567 I258V unknown Het
Igkv13-71-1 G T 6: 69,235,799 noncoding transcript Het
Irx1 A C 13: 71,959,668 S298R probably damaging Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kcnc1 G A 7: 46,435,316 A555T probably benign Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lipo1 T C 19: 33,780,337 D244G probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Macf1 A T 4: 123,432,875 I4943N probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr209 T C 16: 59,361,406 K271E probably benign Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pbx1 T C 1: 168,183,615 D372G possibly damaging Het
Pikfyve T A 1: 65,262,953 S1668T probably damaging Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Plag1 G T 4: 3,904,499 H231N probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Ptpn23 A T 9: 110,393,826 N54K probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rassf9 T A 10: 102,545,753 I332N probably damaging Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rnf214 A G 9: 45,867,821 S389P probably benign Het
Rxfp1 A C 3: 79,667,848 L181R probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Sh3bp4 C A 1: 89,145,489 S686R probably damaging Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stard13 A T 5: 151,062,673 S339R probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Tinag T A 9: 76,996,935 E402V possibly damaging Het
Tmem183a T C 1: 134,361,611 D27G probably damaging Het
Tnfrsf13c T C 15: 82,223,902 T56A probably damaging Het
Tnrc18 A C 5: 142,733,576 L1985R unknown Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Ufl1 G T 4: 25,270,572 Q215K probably benign Het
Unkl T C 17: 25,231,865 *232R probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Xkr4 T C 1: 3,216,570 T466A probably benign Het
Zfp451 T A 1: 33,769,817 K988* probably null Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Supt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Supt6 APN 11 78231181 missense possibly damaging 0.94
IGL01457:Supt6 APN 11 78221143 missense probably damaging 1.00
IGL01608:Supt6 APN 11 78225483 missense probably damaging 1.00
IGL01739:Supt6 APN 11 78222187 missense probably damaging 1.00
IGL01765:Supt6 APN 11 78222159 missense probably benign 0.09
IGL01894:Supt6 APN 11 78222838 missense probably benign 0.00
IGL01952:Supt6 APN 11 78225760 missense probably benign 0.01
IGL02067:Supt6 APN 11 78231157 missense probably benign 0.01
IGL02244:Supt6 APN 11 78232797 missense possibly damaging 0.92
IGL02267:Supt6 APN 11 78226204 missense possibly damaging 0.72
IGL02379:Supt6 APN 11 78225369 missense possibly damaging 0.75
IGL02541:Supt6 APN 11 78226918 missense probably damaging 0.99
IGL02635:Supt6 APN 11 78212739 missense probably damaging 1.00
IGL03347:Supt6 APN 11 78232185 missense possibly damaging 0.71
IGL02980:Supt6 UTSW 11 78225722 missense probably damaging 1.00
IGL02991:Supt6 UTSW 11 78225353 missense probably damaging 1.00
R0145:Supt6 UTSW 11 78208236 missense probably benign 0.22
R0371:Supt6 UTSW 11 78223157 missense probably benign 0.00
R0452:Supt6 UTSW 11 78227003 missense probably damaging 1.00
R0464:Supt6 UTSW 11 78216338 missense probably benign 0.33
R0616:Supt6 UTSW 11 78209495 missense probably damaging 1.00
R0653:Supt6 UTSW 11 78226015 missense probably benign 0.01
R0788:Supt6 UTSW 11 78207772 unclassified probably benign
R1103:Supt6 UTSW 11 78225473 missense possibly damaging 0.59
R1282:Supt6 UTSW 11 78228768 missense possibly damaging 0.83
R1460:Supt6 UTSW 11 78222198 missense possibly damaging 0.93
R1508:Supt6 UTSW 11 78216203 critical splice donor site probably null
R1850:Supt6 UTSW 11 78219877 splice site probably benign
R1854:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R1855:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R2054:Supt6 UTSW 11 78224361 splice site probably benign
R2098:Supt6 UTSW 11 78213261 splice site probably null
R2146:Supt6 UTSW 11 78230932 missense probably damaging 1.00
R2167:Supt6 UTSW 11 78208167 missense possibly damaging 0.94
R4621:Supt6 UTSW 11 78212746 missense possibly damaging 0.65
R4734:Supt6 UTSW 11 78224683 missense probably benign 0.01
R4825:Supt6 UTSW 11 78208134 missense possibly damaging 0.84
R5575:Supt6 UTSW 11 78228961 missense probably damaging 1.00
R5789:Supt6 UTSW 11 78233586 missense unknown
R5889:Supt6 UTSW 11 78212748 missense probably damaging 0.98
R6297:Supt6 UTSW 11 78226059 missense possibly damaging 0.48
R6394:Supt6 UTSW 11 78231065 missense probably damaging 1.00
R6702:Supt6 UTSW 11 78231800 missense possibly damaging 0.93
R6737:Supt6 UTSW 11 78231818 missense probably damaging 0.99
R6751:Supt6 UTSW 11 78208949 missense probably benign 0.09
R6853:Supt6 UTSW 11 78232830 missense possibly damaging 0.85
R7213:Supt6 UTSW 11 78232150 missense probably damaging 1.00
R7259:Supt6 UTSW 11 78207616 missense probably damaging 0.99
X0067:Supt6 UTSW 11 78232675 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCCACATAGATGCAGTTTAGTG -3'
(R):5'- CTCACACCTGAGCAGTTTGG -3'

Sequencing Primer
(F):5'- CACATAGATGCAGTTTAGTGTGGCG -3'
(R):5'- CTGAGCAGTTTGGGGAGAACCTC -3'
Posted On2018-04-02