Incidental Mutation 'R6296:Ahnak'
ID508813
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene NameAHNAK nucleoprotein (desmoyokin)
Synonyms1110004P15Rik, 2310047C17Rik, DY6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R6296 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8989284-9076919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 9003305 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 651 (V651G)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092956
AA Change: V651G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: V651G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
5730559C18Rik C T 1: 136,221,071 probably null Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Adcy5 A G 16: 35,303,710 Y1253C probably damaging Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Adm A G 7: 110,628,354 T26A probably benign Het
Akr7a5 G A 4: 139,318,221 V358I probably benign Het
Ankar T G 1: 72,643,258 T1383P probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cacna1h G A 17: 25,383,079 R1596C probably damaging Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Cfap54 T C 10: 93,066,846 Y148C probably damaging Het
Coa5 A G 1: 37,428,347 S60P probably damaging Het
Col6a2 T C 10: 76,611,049 N342D probably damaging Het
Cyp2c29 T G 19: 39,330,261 I434S possibly damaging Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dusp16 C A 6: 134,720,493 probably null Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Epn1 G A 7: 5,090,123 A145T probably damaging Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Gm6358 T C 16: 89,141,082 S70P unknown Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hsfy2 T A 1: 56,637,192 H62L probably benign Het
Ighm T C 12: 113,421,567 I258V unknown Het
Igkv13-71-1 G T 6: 69,235,799 noncoding transcript Het
Irx1 A C 13: 71,959,668 S298R probably damaging Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kcnc1 G A 7: 46,435,316 A555T probably benign Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lipo1 T C 19: 33,780,337 D244G probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Macf1 A T 4: 123,432,875 I4943N probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr209 T C 16: 59,361,406 K271E probably benign Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pbx1 T C 1: 168,183,615 D372G possibly damaging Het
Pikfyve T A 1: 65,262,953 S1668T probably damaging Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Plag1 G T 4: 3,904,499 H231N probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Ptpn23 A T 9: 110,393,826 N54K probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rassf9 T A 10: 102,545,753 I332N probably damaging Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rnf214 A G 9: 45,867,821 S389P probably benign Het
Rxfp1 A C 3: 79,667,848 L181R probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Sh3bp4 C A 1: 89,145,489 S686R probably damaging Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stard13 A T 5: 151,062,673 S339R probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tinag T A 9: 76,996,935 E402V possibly damaging Het
Tmem183a T C 1: 134,361,611 D27G probably damaging Het
Tnfrsf13c T C 15: 82,223,902 T56A probably damaging Het
Tnrc18 A C 5: 142,733,576 L1985R unknown Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Ufl1 G T 4: 25,270,572 Q215K probably benign Het
Unkl T C 17: 25,231,865 *232R probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Xkr4 T C 1: 3,216,570 T466A probably benign Het
Zfp451 T A 1: 33,769,817 K988* probably null Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 9007223 missense probably damaging 0.99
IGL00509:Ahnak APN 19 9009951 missense possibly damaging 0.94
IGL00539:Ahnak APN 19 9007908 missense possibly damaging 0.50
IGL00558:Ahnak APN 19 9004307 missense possibly damaging 0.93
IGL00567:Ahnak APN 19 9013383 missense probably benign 0.24
IGL00706:Ahnak APN 19 9013730 nonsense probably null
IGL00807:Ahnak APN 19 9008522 missense possibly damaging 0.92
IGL00870:Ahnak APN 19 9013698 missense probably damaging 1.00
IGL01101:Ahnak APN 19 9012887 intron probably benign
IGL01118:Ahnak APN 19 9012578 missense probably damaging 1.00
IGL01288:Ahnak APN 19 9002494 missense possibly damaging 0.94
IGL01324:Ahnak APN 19 9003032 missense probably damaging 1.00
IGL01341:Ahnak APN 19 9011703 missense probably benign
IGL01541:Ahnak APN 19 9007879 missense possibly damaging 0.95
IGL01580:Ahnak APN 19 9002839 missense probably benign 0.02
IGL01595:Ahnak APN 19 9003501 nonsense probably null
IGL01746:Ahnak APN 19 9004912 missense possibly damaging 0.89
IGL01766:Ahnak APN 19 9000118 missense unknown
IGL01821:Ahnak APN 19 9012118 missense probably benign
IGL01913:Ahnak APN 19 9006064 nonsense probably null
IGL01934:Ahnak APN 19 9002657 missense probably damaging 1.00
IGL01940:Ahnak APN 19 9006557 missense probably benign 0.14
IGL01958:Ahnak APN 19 9014909 missense possibly damaging 0.59
IGL02145:Ahnak APN 19 9002855 missense probably benign 0.11
IGL02246:Ahnak APN 19 9008268 missense probably damaging 1.00
IGL02282:Ahnak APN 19 9005987 missense probably damaging 1.00
IGL02428:Ahnak APN 19 9014833 missense possibly damaging 0.83
IGL02442:Ahnak APN 19 9004016 missense probably damaging 1.00
IGL02474:Ahnak APN 19 9004933 missense probably benign 0.13
IGL02483:Ahnak APN 19 9003308 missense probably benign 0.01
IGL02616:Ahnak APN 19 9005627 missense probably benign 0.03
IGL02630:Ahnak APN 19 9012077 missense probably damaging 1.00
IGL02690:Ahnak APN 19 9012584 nonsense probably null
IGL02717:Ahnak APN 19 9002387 missense probably benign 0.00
IGL02721:Ahnak APN 19 9009707 missense probably benign 0.07
IGL02737:Ahnak APN 19 9004593 missense probably benign 0.17
IGL02850:Ahnak APN 19 9002596 missense probably benign 0.00
IGL03071:Ahnak APN 19 9011918 missense possibly damaging 0.63
IGL03072:Ahnak APN 19 9006508 missense probably benign 0.11
IGL03094:Ahnak APN 19 9003547 missense possibly damaging 0.64
IGL03140:Ahnak APN 19 9005212 intron probably benign
IGL03176:Ahnak APN 19 9008166 missense possibly damaging 0.56
IGL03176:Ahnak APN 19 9002449 missense probably damaging 1.00
IGL03189:Ahnak APN 19 9011239 missense possibly damaging 0.65
IGL03357:Ahnak APN 19 9009325 intron probably benign
IGL03371:Ahnak APN 19 9004228 missense possibly damaging 0.91
Eskimo UTSW 19 9009574 missense probably benign 0.31
nanook UTSW 19 9003231 missense probably benign 0.42
netsilik UTSW 19 9002321 missense probably benign 0.00
IGL03097:Ahnak UTSW 19 9002387 missense probably benign 0.00
R0054:Ahnak UTSW 19 9012056 missense probably damaging 1.00
R0094:Ahnak UTSW 19 9013893 missense probably benign 0.12
R0110:Ahnak UTSW 19 9018232 nonsense probably null
R0141:Ahnak UTSW 19 9006680 missense probably damaging 1.00
R0166:Ahnak UTSW 19 9005725 missense probably damaging 1.00
R0309:Ahnak UTSW 19 9002495 missense probably damaging 1.00
R0368:Ahnak UTSW 19 9008350 nonsense probably null
R0386:Ahnak UTSW 19 9011144 missense possibly damaging 0.94
R0401:Ahnak UTSW 19 9015116 missense probably benign 0.24
R0415:Ahnak UTSW 19 9012871 intron probably benign
R0463:Ahnak UTSW 19 9009407 intron probably benign
R0469:Ahnak UTSW 19 9018232 nonsense probably null
R0470:Ahnak UTSW 19 9008967 missense probably benign 0.29
R0487:Ahnak UTSW 19 9007151 missense probably benign 0.00
R0487:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R0499:Ahnak UTSW 19 9000264 splice site probably benign
R0506:Ahnak UTSW 19 9009128 missense probably damaging 1.00
R0510:Ahnak UTSW 19 9018232 nonsense probably null
R0557:Ahnak UTSW 19 9001944 missense probably benign 0.10
R0570:Ahnak UTSW 19 9013698 missense probably damaging 1.00
R0610:Ahnak UTSW 19 9007878 missense probably benign 0.08
R0646:Ahnak UTSW 19 9013402 nonsense probably null
R0659:Ahnak UTSW 19 9015002 missense possibly damaging 0.60
R0791:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0792:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0840:Ahnak UTSW 19 9005063 missense probably damaging 1.00
R0847:Ahnak UTSW 19 9006433 nonsense probably null
R0941:Ahnak UTSW 19 9009914 missense probably damaging 1.00
R0962:Ahnak UTSW 19 9012848 intron probably benign
R1017:Ahnak UTSW 19 9010543 missense probably damaging 0.99
R1037:Ahnak UTSW 19 9007618 missense probably benign 0.27
R1085:Ahnak UTSW 19 9013125 missense possibly damaging 0.50
R1113:Ahnak UTSW 19 9005620 missense probably benign 0.29
R1140:Ahnak UTSW 19 9004245 missense probably damaging 1.00
R1158:Ahnak UTSW 19 9013926 missense probably benign 0.00
R1218:Ahnak UTSW 19 9015619 missense probably damaging 1.00
R1225:Ahnak UTSW 19 9002883 missense probably damaging 1.00
R1245:Ahnak UTSW 19 9004169 missense probably benign 0.44
R1421:Ahnak UTSW 19 9015631 missense possibly damaging 0.95
R1447:Ahnak UTSW 19 9007082 missense probably damaging 0.98
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1471:Ahnak UTSW 19 9012932 intron probably benign
R1507:Ahnak UTSW 19 9010077 missense probably damaging 1.00
R1521:Ahnak UTSW 19 9004728 missense probably benign 0.11
R1568:Ahnak UTSW 19 9002375 missense probably damaging 0.98
R1569:Ahnak UTSW 19 9004094 missense possibly damaging 0.78
R1616:Ahnak UTSW 19 9008987 missense possibly damaging 0.94
R1638:Ahnak UTSW 19 9009449 missense probably benign 0.01
R1680:Ahnak UTSW 19 9009963 missense probably benign 0.05
R1713:Ahnak UTSW 19 9011809 missense possibly damaging 0.95
R1722:Ahnak UTSW 19 9010655 missense probably damaging 0.99
R1771:Ahnak UTSW 19 9013753 missense probably benign 0.24
R1795:Ahnak UTSW 19 9002438 missense possibly damaging 0.79
R1823:Ahnak UTSW 19 9004905 missense probably damaging 0.99
R1842:Ahnak UTSW 19 9005867 missense probably damaging 0.99
R1854:Ahnak UTSW 19 9013832 missense possibly damaging 0.61
R1856:Ahnak UTSW 19 9002048 missense possibly damaging 0.86
R1886:Ahnak UTSW 19 9015979 missense probably damaging 0.98
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1912:Ahnak UTSW 19 9017881 missense probably damaging 1.00
R1913:Ahnak UTSW 19 9007922 missense probably damaging 0.99
R1942:Ahnak UTSW 19 9015083 missense probably damaging 0.98
R1987:Ahnak UTSW 19 9015251 missense probably damaging 1.00
R2006:Ahnak UTSW 19 9007075 missense probably damaging 1.00
R2013:Ahnak UTSW 19 9014573 missense probably damaging 0.98
R2014:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R2047:Ahnak UTSW 19 9014300 missense possibly damaging 0.67
R2048:Ahnak UTSW 19 9007056 missense probably damaging 0.99
R2060:Ahnak UTSW 19 9008041 missense probably benign 0.08
R2083:Ahnak UTSW 19 9011557 missense probably damaging 1.00
R2157:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R2167:Ahnak UTSW 19 9011494 nonsense probably null
R2208:Ahnak UTSW 19 9017732 missense probably benign 0.00
R2224:Ahnak UTSW 19 9012991 intron probably benign
R2268:Ahnak UTSW 19 9010574 missense possibly damaging 0.66
R2420:Ahnak UTSW 19 9009256 missense possibly damaging 0.89
R2426:Ahnak UTSW 19 9002851 missense possibly damaging 0.81
R2910:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2911:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2981:Ahnak UTSW 19 9000148 missense probably damaging 0.97
R3151:Ahnak UTSW 19 9009944 missense probably benign 0.12
R3155:Ahnak UTSW 19 9010177 missense possibly damaging 0.49
R3422:Ahnak UTSW 19 9005708 missense probably benign 0.39
R3422:Ahnak UTSW 19 9006752 missense probably benign 0.05
R3430:Ahnak UTSW 19 9006958 missense probably benign 0.42
R3433:Ahnak UTSW 19 9009994 missense probably benign 0.01
R3711:Ahnak UTSW 19 9007898 missense probably benign
R3723:Ahnak UTSW 19 9016853 missense possibly damaging 0.79
R3775:Ahnak UTSW 19 9009023 missense possibly damaging 0.91
R3858:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3859:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3922:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3924:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3926:Ahnak UTSW 19 9006328 missense probably benign 0.20
R4026:Ahnak UTSW 19 9011299 missense probably damaging 0.97
R4051:Ahnak UTSW 19 9014327 missense probably damaging 1.00
R4209:Ahnak UTSW 19 9002600 missense probably damaging 1.00
R4234:Ahnak UTSW 19 9000786 nonsense probably null
R4237:Ahnak UTSW 19 9001783 missense probably benign 0.02
R4285:Ahnak UTSW 19 9016839 nonsense probably null
R4331:Ahnak UTSW 19 9015820 missense probably damaging 1.00
R4342:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R4430:Ahnak UTSW 19 9003040 missense probably benign 0.00
R4554:Ahnak UTSW 19 9014930 missense probably damaging 1.00
R4602:Ahnak UTSW 19 9010825 missense possibly damaging 0.66
R4612:Ahnak UTSW 19 9003724 missense probably benign 0.44
R4655:Ahnak UTSW 19 9008701 missense probably damaging 1.00
R4656:Ahnak UTSW 19 9004855 missense possibly damaging 0.80
R4700:Ahnak UTSW 19 9004681 missense probably benign 0.02
R4704:Ahnak UTSW 19 9012258 intron probably benign
R4704:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R4705:Ahnak UTSW 19 9016906 missense probably benign 0.07
R4707:Ahnak UTSW 19 9016735 missense probably benign 0.03
R4732:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4733:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4778:Ahnak UTSW 19 9011975 missense possibly damaging 0.79
R4782:Ahnak UTSW 19 9012499 intron probably benign
R4832:Ahnak UTSW 19 9012460 intron probably benign
R4882:Ahnak UTSW 19 9005897 missense probably damaging 0.98
R4884:Ahnak UTSW 19 9012754 intron probably benign
R4895:Ahnak UTSW 19 9017441 missense probably benign 0.43
R4930:Ahnak UTSW 19 9010967 missense possibly damaging 0.79
R4951:Ahnak UTSW 19 9017835 missense probably damaging 1.00
R4968:Ahnak UTSW 19 9015100 missense probably damaging 1.00
R5026:Ahnak UTSW 19 9010631 missense possibly damaging 0.46
R5050:Ahnak UTSW 19 9012458 intron probably benign
R5073:Ahnak UTSW 19 9003231 missense probably benign 0.42
R5110:Ahnak UTSW 19 9014759 missense probably damaging 1.00
R5119:Ahnak UTSW 19 9013644 missense probably benign 0.00
R5128:Ahnak UTSW 19 9017087 missense probably damaging 1.00
R5139:Ahnak UTSW 19 9004655 missense probably damaging 1.00
R5150:Ahnak UTSW 19 9010904 missense possibly damaging 0.46
R5151:Ahnak UTSW 19 9017569 missense probably benign 0.03
R5165:Ahnak UTSW 19 9015665 missense possibly damaging 0.95
R5236:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R5361:Ahnak UTSW 19 9015341 missense possibly damaging 0.92
R5366:Ahnak UTSW 19 9016735 missense possibly damaging 0.65
R5387:Ahnak UTSW 19 9003691 missense probably damaging 1.00
R5396:Ahnak UTSW 19 9007175 missense probably damaging 0.99
R5583:Ahnak UTSW 19 9006917 missense probably damaging 0.99
R5587:Ahnak UTSW 19 9009476 missense possibly damaging 0.88
R5620:Ahnak UTSW 19 9013094 nonsense probably null
R5643:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5644:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5657:Ahnak UTSW 19 9014615 missense probably damaging 0.99
R5688:Ahnak UTSW 19 9002519 missense probably benign 0.01
R5702:Ahnak UTSW 19 9001840 missense probably damaging 1.00
R5727:Ahnak UTSW 19 9016747 missense probably damaging 0.99
R5730:Ahnak UTSW 19 9010253 missense possibly damaging 0.81
R5755:Ahnak UTSW 19 9001732 missense probably benign 0.06
R5760:Ahnak UTSW 19 9013562 missense probably damaging 1.00
R5789:Ahnak UTSW 19 9002321 missense probably benign 0.00
R5790:Ahnak UTSW 19 9015248 missense probably damaging 0.99
R5795:Ahnak UTSW 19 9012382 nonsense probably null
R5808:Ahnak UTSW 19 9010235 missense possibly damaging 0.91
R5867:Ahnak UTSW 19 9010052 missense probably damaging 0.99
R5878:Ahnak UTSW 19 9008342 missense probably damaging 1.00
R5898:Ahnak UTSW 19 9013767 missense possibly damaging 0.63
R5898:Ahnak UTSW 19 9018211 missense probably damaging 1.00
R5912:Ahnak UTSW 19 9011903 missense probably damaging 0.99
R5935:Ahnak UTSW 19 9015182 missense possibly damaging 0.91
R5969:Ahnak UTSW 19 9016585 missense probably damaging 1.00
R5988:Ahnak UTSW 19 9009347 intron probably benign
R6000:Ahnak UTSW 19 9013111 nonsense probably null
R6005:Ahnak UTSW 19 9015161 missense possibly damaging 0.61
R6101:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6105:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6116:Ahnak UTSW 19 9012963 intron probably benign
R6209:Ahnak UTSW 19 9012566 missense probably damaging 1.00
R6240:Ahnak UTSW 19 9013583 missense probably damaging 1.00
R6255:Ahnak UTSW 19 9008025 missense possibly damaging 0.95
R6263:Ahnak UTSW 19 9018277 missense probably benign 0.03
R6287:Ahnak UTSW 19 9015003 missense probably benign 0.02
R6315:Ahnak UTSW 19 9006626 missense probably damaging 0.99
R6328:Ahnak UTSW 19 9007148 missense probably benign 0.11
R6331:Ahnak UTSW 19 9006625 missense probably benign 0.18
R6355:Ahnak UTSW 19 9008762 missense probably benign 0.02
R6409:Ahnak UTSW 19 9009574 missense probably benign 0.31
R6567:Ahnak UTSW 19 9008806 missense probably benign 0.27
R6572:Ahnak UTSW 19 9007976 missense probably damaging 0.99
R6574:Ahnak UTSW 19 9017047 missense probably benign 0.04
R6590:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6620:Ahnak UTSW 19 9015310 missense possibly damaging 0.95
R6690:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6731:Ahnak UTSW 19 9011562 missense possibly damaging 0.85
R6756:Ahnak UTSW 19 9007561 missense possibly damaging 0.59
R6846:Ahnak UTSW 19 9011857 missense possibly damaging 0.66
R6854:Ahnak UTSW 19 9015235 missense probably damaging 1.00
R6857:Ahnak UTSW 19 9037168 nonsense probably null
R6863:Ahnak UTSW 19 9012365 intron probably benign
R6876:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R6958:Ahnak UTSW 19 9015215 missense possibly damaging 0.88
R7126:Ahnak UTSW 19 9002359 missense not run
X0021:Ahnak UTSW 19 9013619 missense probably damaging 0.99
X0027:Ahnak UTSW 19 9012037 missense probably damaging 1.00
Z1088:Ahnak UTSW 19 9016082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTGTAGATGTCATTCTCCCC -3'
(R):5'- TCCACTTTGGAGCCTTTCAG -3'

Sequencing Primer
(F):5'- GTCATTCTCCCCAATGTAGAAGG -3'
(R):5'- CCCCTCAAGCTTTGGTGGTG -3'
Posted On2018-04-02