Incidental Mutation 'R6297:Pdgfra'
ID508833
Institutional Source Beutler Lab
Gene Symbol Pdgfra
Ensembl Gene ENSMUSG00000029231
Gene Nameplatelet derived growth factor receptor, alpha polypeptide
SynonymsPdgfr-2, CD140a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6297 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location75152292-75198215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75173474 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 403 (K403E)
Ref Sequence ENSEMBL: ENSMUSP00000144543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000476] [ENSMUST00000168162] [ENSMUST00000201711] [ENSMUST00000202186] [ENSMUST00000202681]
Predicted Effect probably benign
Transcript: ENSMUST00000000476
AA Change: K403E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000000476
Gene: ENSMUSG00000029231
AA Change: K403E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168162
AA Change: K403E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127173
Gene: ENSMUSG00000029231
AA Change: K403E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
TyrKc 593 950 8.51e-141 SMART
Blast:TyrKc 960 991 3e-8 BLAST
low complexity region 1063 1082 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183797
Predicted Effect probably benign
Transcript: ENSMUST00000201711
AA Change: K403E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143891
Gene: ENSMUSG00000029231
AA Change: K403E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
Pfam:Pkinase 593 701 9.9e-14 PFAM
Pfam:Pkinase_Tyr 593 750 5.2e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202186
AA Change: K403E

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144543
Gene: ENSMUSG00000029231
AA Change: K403E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 2.6e-5 SMART
IG_like 135 206 7e-2 SMART
IGc2 226 297 3.6e-6 SMART
IG 322 414 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202681
AA Change: K403E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143906
Gene: ENSMUSG00000029231
AA Change: K403E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 34 122 6.07e-3 SMART
IG_like 135 206 1.7e1 SMART
IGc2 226 297 8.72e-4 SMART
IG 322 414 2.86e0 SMART
transmembrane domain 527 549 N/A INTRINSIC
Pfam:Pkinase 593 701 9.9e-14 PFAM
Pfam:Pkinase_Tyr 593 750 5.2e-32 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of proteins. Binding of platelet-derived growth factor protein ligands to this receptor triggers receptor dimerization and autophosphorylation, resulting in the activation of several downstream signaling pathways. Signaling through the encoded receptor plays a role in gastrulation and the development of nearly all organ systems. Mice lacking a functional copy of this gene reportedly exhibit defects in lung, skeleton, testis and the central nervous system, and die soon after birth. Alternative splicing and intronic polyadenylation of gene transcripts have been implicated in muscle regeneration and fibrosis in adult mice. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygotes for targeted null mutations exhibit incomplete cephalic closure, increased apoptosis of neural crest cells, impaired myotome and testis formation, abnormal mucosal linings, thoracic skeletal defects, and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,132,530 V1205A probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Ate1 A G 7: 130,503,840 V316A probably damaging Het
Bpifa1 A G 2: 154,144,260 I102V probably benign Het
Catsperb A G 12: 101,591,396 probably null Het
Ccdc47 T C 11: 106,203,601 Y324C probably damaging Het
Cdh22 T C 2: 165,143,644 K341E possibly damaging Het
Cenpb A G 2: 131,178,369 probably benign Het
Dgkd A G 1: 87,926,144 I570V possibly damaging Het
Dhx32 A T 7: 133,742,800 Y27N probably damaging Het
Dnah10 A G 5: 124,775,080 D1824G possibly damaging Het
E130309D02Rik A T 5: 143,308,032 L230Q possibly damaging Het
Fbxo8 T A 8: 56,569,288 C112S probably damaging Het
Fndc3a T C 14: 72,563,540 D590G probably damaging Het
Gm19965 T A 1: 116,822,680 I697N possibly damaging Het
Gm35911 A G 5: 99,941,233 Y119C probably damaging Het
Greb1l G A 18: 10,469,494 D170N probably damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Igfn1 A T 1: 135,964,661 probably null Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Lman2 T C 13: 55,348,431 N267S probably damaging Het
Lrfn5 A T 12: 61,843,562 I546F probably benign Het
Lrrc4c T C 2: 97,629,619 S197P probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mdga2 A G 12: 66,506,253 Y793H probably damaging Het
Mdn1 C T 4: 32,730,054 R2799* probably null Het
Mup13 T A 4: 61,225,635 I148F probably benign Het
Olfr1023 A G 2: 85,886,815 N5S probably benign Het
Olfr170 A C 16: 19,605,930 V246G possibly damaging Het
Olfr968 A T 9: 39,772,226 D191E possibly damaging Het
Pigz A T 16: 31,944,937 Y271F probably damaging Het
Plekhg4 T C 8: 105,377,840 L517P probably damaging Het
Rnf20 T C 4: 49,642,132 L232P probably damaging Het
Rpa3 C A 6: 8,256,767 G71* probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rubcnl A G 14: 75,050,144 T623A probably benign Het
Sltm A G 9: 70,581,359 D597G probably damaging Het
Stpg2 T C 3: 139,701,671 V528A possibly damaging Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tas1r2 T A 4: 139,662,050 M419K possibly damaging Het
Txndc16 T C 14: 45,151,786 T486A probably benign Het
Vmn1r185 A G 7: 26,611,621 V153A probably benign Het
Vmn2r48 T C 7: 9,934,880 N548D probably damaging Het
Washc5 A G 15: 59,344,046 I378T possibly damaging Het
Wdr37 A G 13: 8,842,728 probably null Het
Xrn2 G A 2: 147,026,570 R181H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Other mutations in Pdgfra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pdgfra APN 5 75163679 missense probably benign 0.40
IGL00574:Pdgfra APN 5 75181047 missense probably damaging 1.00
IGL00906:Pdgfra APN 5 75180173 missense probably benign 0.00
IGL00964:Pdgfra APN 5 75175065 missense probably damaging 1.00
IGL01467:Pdgfra APN 5 75185631 critical splice donor site probably null
IGL01485:Pdgfra APN 5 75163652 missense probably benign 0.02
IGL01556:Pdgfra APN 5 75177691 missense probably damaging 1.00
IGL01949:Pdgfra APN 5 75170665 missense probably damaging 0.98
IGL02066:Pdgfra APN 5 75170580 missense possibly damaging 0.55
IGL02271:Pdgfra APN 5 75187906 missense probably damaging 1.00
IGL02726:Pdgfra APN 5 75194957 nonsense probably null
IGL02858:Pdgfra APN 5 75194974 missense probably damaging 1.00
IGL03306:Pdgfra APN 5 75192533 missense possibly damaging 0.49
P0033:Pdgfra UTSW 5 75192561 missense probably damaging 1.00
PIT4472001:Pdgfra UTSW 5 75180246 missense probably damaging 1.00
R0134:Pdgfra UTSW 5 75166511 missense probably damaging 1.00
R0200:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0254:Pdgfra UTSW 5 75167935 missense probably damaging 1.00
R0331:Pdgfra UTSW 5 75195052 missense probably damaging 1.00
R0467:Pdgfra UTSW 5 75195036 missense probably damaging 1.00
R0532:Pdgfra UTSW 5 75170773 missense probably benign 0.00
R0608:Pdgfra UTSW 5 75163777 missense probably damaging 1.00
R0765:Pdgfra UTSW 5 75187987 unclassified probably benign
R1171:Pdgfra UTSW 5 75173447 missense probably damaging 0.98
R1372:Pdgfra UTSW 5 75189263 missense probably damaging 0.96
R1530:Pdgfra UTSW 5 75189010 splice site probably null
R1585:Pdgfra UTSW 5 75192603 missense probably damaging 1.00
R1666:Pdgfra UTSW 5 75189020 missense possibly damaging 0.94
R1836:Pdgfra UTSW 5 75183014 missense possibly damaging 0.95
R1868:Pdgfra UTSW 5 75170873 missense probably benign 0.43
R1923:Pdgfra UTSW 5 75163733 missense probably benign 0.03
R2075:Pdgfra UTSW 5 75187948 missense probably damaging 1.00
R2261:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R2262:Pdgfra UTSW 5 75185523 missense probably benign 0.03
R3028:Pdgfra UTSW 5 75174981 missense probably damaging 1.00
R3236:Pdgfra UTSW 5 75167936 missense probably damaging 1.00
R3692:Pdgfra UTSW 5 75189287 missense possibly damaging 0.54
R3701:Pdgfra UTSW 5 75180220 nonsense probably null
R3890:Pdgfra UTSW 5 75167927 missense probably null 0.57
R3901:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R3902:Pdgfra UTSW 5 75192508 missense probably benign 0.10
R4272:Pdgfra UTSW 5 75183070 missense probably benign 0.05
R4532:Pdgfra UTSW 5 75181083 missense probably damaging 1.00
R4660:Pdgfra UTSW 5 75162271 missense possibly damaging 0.82
R4753:Pdgfra UTSW 5 75181524 missense probably damaging 1.00
R4795:Pdgfra UTSW 5 75189311 missense probably benign
R4796:Pdgfra UTSW 5 75189311 missense probably benign
R4884:Pdgfra UTSW 5 75189312 missense probably benign 0.07
R4936:Pdgfra UTSW 5 75195026 missense probably damaging 1.00
R5625:Pdgfra UTSW 5 75189337 critical splice donor site probably null
R5666:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5670:Pdgfra UTSW 5 75173495 missense probably benign 0.00
R5714:Pdgfra UTSW 5 75186012 missense probably damaging 1.00
R5836:Pdgfra UTSW 5 75163774 missense possibly damaging 0.52
R6126:Pdgfra UTSW 5 75170529 missense probably benign 0.09
R6141:Pdgfra UTSW 5 75173396 missense probably damaging 0.98
R6363:Pdgfra UTSW 5 75170836 missense possibly damaging 0.91
R6376:Pdgfra UTSW 5 75166519 missense probably benign 0.02
R6485:Pdgfra UTSW 5 75175074 splice site probably null
R6612:Pdgfra UTSW 5 75167842 missense probably benign 0.01
R6641:Pdgfra UTSW 5 75162101 intron probably benign
R6954:Pdgfra UTSW 5 75173394 missense possibly damaging 0.82
R7110:Pdgfra UTSW 5 75189234 nonsense probably null
R7192:Pdgfra UTSW 5 75183106 missense probably damaging 1.00
R7294:Pdgfra UTSW 5 75181651 missense probably benign 0.05
Z1088:Pdgfra UTSW 5 75166577 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTTCAATGTGTGGAAACTAGATC -3'
(R):5'- ATTTTCAGGCACGACAACACG -3'

Sequencing Primer
(F):5'- GAAGCTGCTTAAATAATCGGT -3'
(R):5'- AACACGGTCCTGACATGCG -3'
Posted On2018-04-02