Incidental Mutation 'R6297:Ccdc47'
ID508850
Institutional Source Beutler Lab
Gene Symbol Ccdc47
Ensembl Gene ENSMUSG00000078622
Gene Namecoiled-coil domain containing 47
Synonymscalumin, asp4, 2610204L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6297 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106197408-106216344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106203601 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 324 (Y324C)
Ref Sequence ENSEMBL: ENSMUSP00000002043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002043] [ENSMUST00000106865] [ENSMUST00000137915]
Predicted Effect probably damaging
Transcript: ENSMUST00000002043
AA Change: Y324C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002043
Gene: ENSMUSG00000078622
AA Change: Y324C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 38 N/A INTRINSIC
Pfam:DUF1682 134 467 2.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106865
AA Change: Y8C

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102478
Gene: ENSMUSG00000078622
AA Change: Y8C

DomainStartEndE-ValueType
Pfam:DUF1682 1 158 9.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122989
Predicted Effect unknown
Transcript: ENSMUST00000125383
AA Change: Y70C
SMART Domains Protein: ENSMUSP00000122736
Gene: ENSMUSG00000078622
AA Change: Y70C

DomainStartEndE-ValueType
Pfam:DUF1682 1 212 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137915
SMART Domains Protein: ENSMUSP00000117127
Gene: ENSMUSG00000078622

DomainStartEndE-ValueType
Pfam:DUF1682 13 138 3.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153982
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: More than half of homozygous null mice die at early embryonic stages while the rest die shortly after birth. Mouse embryonic fibroblasts display insufficient Ca2+ contents in intracellular stores, impaired store-operated Ca2+ entry, and enhanced endoplasmic reticulum stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,132,530 V1205A probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Ate1 A G 7: 130,503,840 V316A probably damaging Het
Bpifa1 A G 2: 154,144,260 I102V probably benign Het
Catsperb A G 12: 101,591,396 probably null Het
Cdh22 T C 2: 165,143,644 K341E possibly damaging Het
Cenpb A G 2: 131,178,369 probably benign Het
Dgkd A G 1: 87,926,144 I570V possibly damaging Het
Dhx32 A T 7: 133,742,800 Y27N probably damaging Het
Dnah10 A G 5: 124,775,080 D1824G possibly damaging Het
E130309D02Rik A T 5: 143,308,032 L230Q possibly damaging Het
Fbxo8 T A 8: 56,569,288 C112S probably damaging Het
Fndc3a T C 14: 72,563,540 D590G probably damaging Het
Gm19965 T A 1: 116,822,680 I697N possibly damaging Het
Gm35911 A G 5: 99,941,233 Y119C probably damaging Het
Greb1l G A 18: 10,469,494 D170N probably damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Igfn1 A T 1: 135,964,661 probably null Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Lman2 T C 13: 55,348,431 N267S probably damaging Het
Lrfn5 A T 12: 61,843,562 I546F probably benign Het
Lrrc4c T C 2: 97,629,619 S197P probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mdga2 A G 12: 66,506,253 Y793H probably damaging Het
Mdn1 C T 4: 32,730,054 R2799* probably null Het
Mup13 T A 4: 61,225,635 I148F probably benign Het
Olfr1023 A G 2: 85,886,815 N5S probably benign Het
Olfr170 A C 16: 19,605,930 V246G possibly damaging Het
Olfr968 A T 9: 39,772,226 D191E possibly damaging Het
Pdgfra A G 5: 75,173,474 K403E possibly damaging Het
Pigz A T 16: 31,944,937 Y271F probably damaging Het
Plekhg4 T C 8: 105,377,840 L517P probably damaging Het
Rnf20 T C 4: 49,642,132 L232P probably damaging Het
Rpa3 C A 6: 8,256,767 G71* probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rubcnl A G 14: 75,050,144 T623A probably benign Het
Sltm A G 9: 70,581,359 D597G probably damaging Het
Stpg2 T C 3: 139,701,671 V528A possibly damaging Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tas1r2 T A 4: 139,662,050 M419K possibly damaging Het
Txndc16 T C 14: 45,151,786 T486A probably benign Het
Vmn1r185 A G 7: 26,611,621 V153A probably benign Het
Vmn2r48 T C 7: 9,934,880 N548D probably damaging Het
Washc5 A G 15: 59,344,046 I378T possibly damaging Het
Wdr37 A G 13: 8,842,728 probably null Het
Xrn2 G A 2: 147,026,570 R181H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Other mutations in Ccdc47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ccdc47 APN 11 106203532 splice site probably null
IGL01890:Ccdc47 APN 11 106205451 missense probably damaging 1.00
IGL02026:Ccdc47 APN 11 106205027 missense probably damaging 0.96
IGL03343:Ccdc47 APN 11 106204962 missense probably damaging 0.99
PIT4677001:Ccdc47 UTSW 11 106208208 missense probably damaging 1.00
R1508:Ccdc47 UTSW 11 106202416 missense probably damaging 1.00
R2239:Ccdc47 UTSW 11 106202134 missense possibly damaging 0.93
R3103:Ccdc47 UTSW 11 106202841 missense probably benign 0.00
R3935:Ccdc47 UTSW 11 106201997 unclassified probably benign
R4783:Ccdc47 UTSW 11 106203604 missense probably benign 0.03
R5150:Ccdc47 UTSW 11 106205439 missense possibly damaging 0.92
R5331:Ccdc47 UTSW 11 106210350 missense probably benign 0.17
R5362:Ccdc47 UTSW 11 106208213 synonymous probably null
R5417:Ccdc47 UTSW 11 106210350 missense probably benign 0.17
R5420:Ccdc47 UTSW 11 106210350 missense probably benign 0.17
R5473:Ccdc47 UTSW 11 106205029 missense probably damaging 0.98
R6449:Ccdc47 UTSW 11 106204985 missense probably damaging 1.00
R6981:Ccdc47 UTSW 11 106202737 missense probably benign 0.04
R7136:Ccdc47 UTSW 11 106205004 missense probably benign 0.01
R7170:Ccdc47 UTSW 11 106202478 missense probably benign 0.01
R7340:Ccdc47 UTSW 11 106200973 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GAGGCCATACTTCTAAACACTTTTGC -3'
(R):5'- TCCTGTCATGGGAGGGACTAAG -3'

Sequencing Primer
(F):5'- TCCGAGAAGGGTGTCAAATCTCC -3'
(R):5'- AAGCTTGGGAGTGCACTA -3'
Posted On2018-04-02