Incidental Mutation 'R6299:Ppp1cb'
ID508958
Institutional Source Beutler Lab
Gene Symbol Ppp1cb
Ensembl Gene ENSMUSG00000014956
Gene Nameprotein phosphatase 1, catalytic subunit, beta isoform
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location32458843-32517433 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 32483454 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 27 (C27*)
Ref Sequence ENSEMBL: ENSMUSP00000144167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015100] [ENSMUST00000201360] [ENSMUST00000201880] [ENSMUST00000202078]
Predicted Effect probably null
Transcript: ENSMUST00000015100
AA Change: C170*
SMART Domains Protein: ENSMUSP00000015100
Gene: ENSMUSG00000014956
AA Change: C170*

DomainStartEndE-ValueType
PP2Ac 29 299 1.14e-164 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201207
Predicted Effect probably null
Transcript: ENSMUST00000201360
AA Change: C170*
SMART Domains Protein: ENSMUSP00000144047
Gene: ENSMUSG00000014956
AA Change: C170*

DomainStartEndE-ValueType
PP2Ac 29 299 1.14e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201880
SMART Domains Protein: ENSMUSP00000144350
Gene: ENSMUSG00000014956

DomainStartEndE-ValueType
PP2Ac 1 72 1.1e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202078
AA Change: C27*
SMART Domains Protein: ENSMUSP00000144167
Gene: ENSMUSG00000014956
AA Change: C27*

DomainStartEndE-ValueType
Blast:PP2Ac 1 56 7e-25 BLAST
SCOP:d1auia_ 18 53 4e-11 SMART
PDB:1S70|A 18 56 5e-21 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Mouse studies suggest that PP1 functions as a suppressor of learning and memory. Two alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Ppp1cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Ppp1cb APN 5 32485338 splice site probably benign
IGL00908:Ppp1cb APN 5 32478068 nonsense probably null
IGL01881:Ppp1cb APN 5 32478143 missense probably benign 0.15
IGL02210:Ppp1cb APN 5 32483474 splice site probably benign
R0081:Ppp1cb UTSW 5 32487614 missense probably damaging 1.00
R0124:Ppp1cb UTSW 5 32483478 splice site probably benign
R1137:Ppp1cb UTSW 5 32487671 missense probably damaging 1.00
R2198:Ppp1cb UTSW 5 32483360 missense probably damaging 1.00
R5371:Ppp1cb UTSW 5 32485988 missense probably damaging 1.00
R5931:Ppp1cb UTSW 5 32483466 critical splice donor site probably null
R6781:Ppp1cb UTSW 5 32480762 missense probably damaging 1.00
R7238:Ppp1cb UTSW 5 32491032 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGCATGAAACTGAACATAGC -3'
(R):5'- AGGCCCAGTGAAGAATTTCC -3'

Sequencing Primer
(F):5'- CTGTGATAACTCCAGCTGTGTCAAG -3'
(R):5'- GGCCCAGTGAAGAATTTCCTATTTTG -3'
Posted On2018-04-02