Incidental Mutation 'R6299:Haus3'
ID508959
Institutional Source Beutler Lab
Gene Symbol Haus3
Ensembl Gene ENSMUSG00000079555
Gene NameHAUS augmin-like complex, subunit 3
SynonymsD5H4S43, D4S43h, D5H4S43E
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location34153880-34169527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34167796 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 173 (V173A)
Ref Sequence ENSEMBL: ENSMUSP00000049973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000060049] [ENSMUST00000202042] [ENSMUST00000202409] [ENSMUST00000202541] [ENSMUST00000202638]
Predicted Effect probably benign
Transcript: ENSMUST00000042954
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060049
AA Change: V173A

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049973
Gene: ENSMUSG00000079555
AA Change: V173A

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 282 4.8e-85 PFAM
coiled coil region 294 336 N/A INTRINSIC
coiled coil region 459 495 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201069
Predicted Effect probably benign
Transcript: ENSMUST00000202042
SMART Domains Protein: ENSMUSP00000144049
Gene: ENSMUSG00000079555

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 96 7.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202290
Predicted Effect probably benign
Transcript: ENSMUST00000202409
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202541
Predicted Effect probably benign
Transcript: ENSMUST00000202638
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the HAUS augmin-like protein complex, which plays a key role in cytokinesis and mitosis. Disruption of the encoded protein causes mitotic defects resulting from fragmentation of centrosomes and microtubule destabilization. This gene shares its 5' exons with some transcripts from overlapping GeneID: 353497, which encodes a DNA polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit pre- or peri-implantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Haus3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Haus3 APN 5 34167928 missense probably benign 0.00
IGL00990:Haus3 APN 5 34166346 missense probably benign 0.00
IGL01311:Haus3 APN 5 34167644 nonsense probably null
IGL01906:Haus3 APN 5 34168323 intron probably benign
IGL01964:Haus3 APN 5 34166061 missense probably benign 0.19
IGL02383:Haus3 APN 5 34166236 nonsense probably null
IGL02584:Haus3 APN 5 34166258 nonsense probably null
IGL02800:Haus3 APN 5 34166324 missense possibly damaging 0.94
IGL03010:Haus3 APN 5 34166287 missense probably benign 0.04
IGL03371:Haus3 APN 5 34166343 nonsense probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0238:Haus3 UTSW 5 34166256 missense possibly damaging 0.54
R0238:Haus3 UTSW 5 34166256 missense possibly damaging 0.54
R0701:Haus3 UTSW 5 34166015 missense probably benign 0.05
R1527:Haus3 UTSW 5 34154053 missense probably benign 0.00
R1714:Haus3 UTSW 5 34163697 missense probably benign 0.03
R1800:Haus3 UTSW 5 34163572 missense probably damaging 1.00
R4874:Haus3 UTSW 5 34167628 missense probably benign 0.07
R4895:Haus3 UTSW 5 34168070 missense probably benign 0.33
R5268:Haus3 UTSW 5 34166105 missense probably damaging 0.98
R5613:Haus3 UTSW 5 34167829 missense probably damaging 0.98
R6701:Haus3 UTSW 5 34167734 missense probably damaging 0.99
R7414:Haus3 UTSW 5 34166133 missense probably benign
X0019:Haus3 UTSW 5 34163556 nonsense probably null
X0063:Haus3 UTSW 5 34166222 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTTCGTGCATGCCCTGAAAG -3'
(R):5'- TGGATGAAGTTCTTAGGACCTG -3'

Sequencing Primer
(F):5'- TCGTGCATGCCCTGAAAGAATTG -3'
(R):5'- TTAGAGGATGAGGTTCAAACTCTGC -3'
Posted On2018-04-02