Incidental Mutation 'R6301:Ltk'
ID509077
Institutional Source Beutler Lab
Gene Symbol Ltk
Ensembl Gene ENSMUSG00000027297
Gene Nameleukocyte tyrosine kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119751320-119760431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119751757 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 838 (S838P)
Ref Sequence ENSEMBL: ENSMUSP00000028759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028758] [ENSMUST00000028759] [ENSMUST00000082130] [ENSMUST00000140224] [ENSMUST00000182203]
Predicted Effect probably benign
Transcript: ENSMUST00000028758
SMART Domains Protein: ENSMUSP00000028758
Gene: ENSMUSG00000027296

DomainStartEndE-ValueType
low complexity region 40 64 N/A INTRINSIC
low complexity region 116 149 N/A INTRINSIC
Pfam:IPK 243 454 1.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028759
AA Change: S838P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028759
Gene: ENSMUSG00000027297
AA Change: S838P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 111 381 2.4e-21 PFAM
transmembrane domain 423 445 N/A INTRINSIC
TyrKc 506 773 2.61e-127 SMART
low complexity region 824 841 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082130
AA Change: S777P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080774
Gene: ENSMUSG00000027297
AA Change: S777P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 109 294 6.1e-16 PFAM
transmembrane domain 362 384 N/A INTRINSIC
TyrKc 445 712 2.61e-127 SMART
low complexity region 763 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134295
Predicted Effect probably benign
Transcript: ENSMUST00000140224
AA Change: S426P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000123020
Gene: ENSMUSG00000027297
AA Change: S426P

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 1.2e-129 SMART
low complexity region 512 529 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182203
AA Change: S526P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138201
Gene: ENSMUSG00000027297
AA Change: S526P

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 2.61e-127 SMART
low complexity region 512 529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ros/insulin receptor family of tyrosine kinases. Tyrosine-specific phosphorylation of proteins is a key to the control of diverse pathways leading to cell growth and differentiation. Four alternatively spliced transcript variants encoding different isoforms have been described for this gene. These transcripts are expressed in a tissue-specific manner in lymphocytes, brain and neuroblastoma cells, and the encoded isoforms exhibit different subcellular localization. The lymphocyte and brain specific variants initiate translation at non-AUG (CUG) start codons. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bcas2 T A 3: 103,171,871 probably benign Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Gm884 A T 11: 103,618,930 probably benign Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Hook3 C T 8: 26,034,940 W26* probably null Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Myh4 G A 11: 67,255,333 E1406K possibly damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxsm A T 14: 16,242,220 I183N probably damaging Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pgghg A T 7: 140,946,376 T585S probably damaging Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Rp1 T C 1: 4,347,254 K1212E probably benign Het
Sgca A C 11: 94,972,567 L28V probably damaging Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
St8sia5 A T 18: 77,246,140 N165Y probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in Ltk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ltk APN 2 119755605 splice site probably benign
IGL01287:Ltk APN 2 119755705 missense probably benign 0.26
IGL01339:Ltk APN 2 119752974 missense probably damaging 1.00
IGL01614:Ltk APN 2 119753487 missense probably damaging 1.00
IGL01827:Ltk APN 2 119752738 missense probably damaging 1.00
IGL02229:Ltk APN 2 119758573 missense probably benign 0.01
R2105:Ltk UTSW 2 119752088 missense probably damaging 1.00
R3763:Ltk UTSW 2 119751837 missense probably benign 0.01
R4119:Ltk UTSW 2 119757948 intron probably benign
R4120:Ltk UTSW 2 119757948 intron probably benign
R4257:Ltk UTSW 2 119753004 missense possibly damaging 0.52
R4460:Ltk UTSW 2 119755613 critical splice donor site probably null
R4888:Ltk UTSW 2 119753227 missense probably damaging 1.00
R5121:Ltk UTSW 2 119753227 missense probably damaging 1.00
R5696:Ltk UTSW 2 119759599 missense probably benign 0.00
R5784:Ltk UTSW 2 119754359 nonsense probably null
R6470:Ltk UTSW 2 119753035 splice site probably null
R6860:Ltk UTSW 2 119754594 nonsense probably null
R7083:Ltk UTSW 2 119752074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGGGTCTGGGCTAGTTTCC -3'
(R):5'- CTGATGTGCTGAACTCACCC -3'

Sequencing Primer
(F):5'- TGCCTGAACATGCAGCACAG -3'
(R):5'- GCTGAACTCACCCCTGCC -3'
Posted On2018-04-02