Incidental Mutation 'R6301:Pgghg'
ID509099
Institutional Source Beutler Lab
Gene Symbol Pgghg
Ensembl Gene ENSMUSG00000062031
Gene Nameprotein glucosylgalactosylhydroxylysine glucosidase
Synonyms5730511L01Rik, Athl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140941391-140947664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140946376 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 585 (T585S)
Ref Sequence ENSEMBL: ENSMUSP00000128214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026562] [ENSMUST00000079403] [ENSMUST00000163094] [ENSMUST00000164580] [ENSMUST00000211129]
Predicted Effect probably benign
Transcript: ENSMUST00000026562
SMART Domains Protein: ENSMUSP00000026562
Gene: ENSMUSG00000025489

DomainStartEndE-ValueType
Pfam:CD225 26 102 1.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079403
AA Change: T585S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078372
Gene: ENSMUSG00000062031
AA Change: T585S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164337
SMART Domains Protein: ENSMUSP00000127119
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 219 464 3.8e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164580
AA Change: T585S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128214
Gene: ENSMUSG00000062031
AA Change: T585S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.6e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169736
Predicted Effect probably benign
Transcript: ENSMUST00000211129
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bcas2 T A 3: 103,171,871 probably benign Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Gm884 A T 11: 103,618,930 probably benign Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Hook3 C T 8: 26,034,940 W26* probably null Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltk A G 2: 119,751,757 S838P probably damaging Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Myh4 G A 11: 67,255,333 E1406K possibly damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxsm A T 14: 16,242,220 I183N probably damaging Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Rp1 T C 1: 4,347,254 K1212E probably benign Het
Sgca A C 11: 94,972,567 L28V probably damaging Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
St8sia5 A T 18: 77,246,140 N165Y probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in Pgghg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Pgghg APN 7 140945351 critical splice donor site probably null
IGL00848:Pgghg APN 7 140942404 missense probably damaging 1.00
IGL01903:Pgghg APN 7 140946828 missense probably benign 0.03
IGL02060:Pgghg APN 7 140946633 missense probably benign 0.30
IGL02475:Pgghg APN 7 140945720 missense probably benign 0.00
IGL02519:Pgghg APN 7 140944981 missense possibly damaging 0.94
IGL02612:Pgghg APN 7 140946338 missense probably damaging 1.00
R0689:Pgghg UTSW 7 140943278 missense probably benign 0.08
R1696:Pgghg UTSW 7 140945311 missense possibly damaging 0.55
R1960:Pgghg UTSW 7 140943347 missense probably benign
R2110:Pgghg UTSW 7 140943540 missense possibly damaging 0.72
R3809:Pgghg UTSW 7 140945295 missense probably damaging 1.00
R3890:Pgghg UTSW 7 140945703 missense probably damaging 0.99
R3891:Pgghg UTSW 7 140945703 missense probably damaging 0.99
R4622:Pgghg UTSW 7 140941496 unclassified probably null
R5009:Pgghg UTSW 7 140943390 missense probably benign
R5058:Pgghg UTSW 7 140942542 missense possibly damaging 0.46
R5215:Pgghg UTSW 7 140946564 missense possibly damaging 0.64
R6122:Pgghg UTSW 7 140943395 missense possibly damaging 0.87
R6269:Pgghg UTSW 7 140946184 missense probably damaging 0.97
R6562:Pgghg UTSW 7 140946593 missense probably benign 0.01
R7054:Pgghg UTSW 7 140944718 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATGTCACTGAGCCCTTCAAG -3'
(R):5'- ATCTTGTTCCCCAGGTAGGAG -3'

Sequencing Primer
(F):5'- TGAGCCCTTCAAGGTCAGC -3'
(R):5'- TAGGAGATACCAGAGACAGATACTC -3'
Posted On2018-04-02