Incidental Mutation 'R6301:Myh4'
ID509112
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Namemyosin, heavy polypeptide 4, skeletal muscle
SynonymsMM, Minimsc, MYH-2B, MyHC-IIb, Minmus, MHC2B, Myhsf
MMRRC Submission
Accession Numbers

Genbank: NM_010855; MGI: 1339713

Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67238029-67260446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67255333 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1406 (E1406K)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018632
AA Change: E1406K

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: E1406K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170942
AA Change: E1406K

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: E1406K

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bcas2 T A 3: 103,171,871 probably benign Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Gm884 A T 11: 103,618,930 probably benign Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Hook3 C T 8: 26,034,940 W26* probably null Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltk A G 2: 119,751,757 S838P probably damaging Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxsm A T 14: 16,242,220 I183N probably damaging Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pgghg A T 7: 140,946,376 T585S probably damaging Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Rp1 T C 1: 4,347,254 K1212E probably benign Het
Sgca A C 11: 94,972,567 L28V probably damaging Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
St8sia5 A T 18: 77,246,140 N165Y probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67255379 missense probably damaging 1.00
IGL01600:Myh4 APN 11 67260189 missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67243419 splice site probably benign
IGL02208:Myh4 APN 11 67251934 missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67245547 missense probably damaging 1.00
IGL02376:Myh4 APN 11 67245728 missense probably benign 0.00
IGL02429:Myh4 APN 11 67258982 nonsense probably null
IGL02450:Myh4 APN 11 67251809 missense probably damaging 1.00
IGL02524:Myh4 APN 11 67249240 missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67256479 missense probably benign
IGL03024:Myh4 APN 11 67248479 missense probably damaging 1.00
IGL03065:Myh4 APN 11 67259156 missense probably benign 0.12
IGL03084:Myh4 APN 11 67251951 splice site probably null
IGL03188:Myh4 APN 11 67246543 critical splice donor site probably null
IGL03204:Myh4 APN 11 67250296 missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67252216 missense probably damaging 0.99
IGL03345:Myh4 APN 11 67255478 missense probably damaging 1.00
F6893:Myh4 UTSW 11 67255457 missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67258832 missense probably benign 0.01
PIT4458001:Myh4 UTSW 11 67240995 missense possibly damaging 0.56
R0099:Myh4 UTSW 11 67259347 missense probably benign
R0194:Myh4 UTSW 11 67252336 missense probably damaging 1.00
R0346:Myh4 UTSW 11 67260326 missense probably benign
R0427:Myh4 UTSW 11 67258653 missense probably damaging 0.98
R0483:Myh4 UTSW 11 67252297 missense probably damaging 1.00
R0571:Myh4 UTSW 11 67250331 missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67259147 missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67242863 missense probably damaging 1.00
R0946:Myh4 UTSW 11 67251751 missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67255706 missense probably null 0.01
R1162:Myh4 UTSW 11 67258613 missense probably damaging 0.97
R1194:Myh4 UTSW 11 67255734 critical splice donor site probably null
R1347:Myh4 UTSW 11 67244741 splice site probably benign
R1457:Myh4 UTSW 11 67248461 missense probably damaging 0.99
R1531:Myh4 UTSW 11 67250540 missense probably benign 0.01
R1716:Myh4 UTSW 11 67250309 missense possibly damaging 0.92
R1766:Myh4 UTSW 11 67256295 missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67260324 missense probably benign
R1856:Myh4 UTSW 11 67255682 missense probably damaging 1.00
R1873:Myh4 UTSW 11 67254743 missense probably benign 0.16
R2069:Myh4 UTSW 11 67246366 splice site probably benign
R2370:Myh4 UTSW 11 67255628 missense probably damaging 1.00
R2406:Myh4 UTSW 11 67259174 missense probably damaging 1.00
R2414:Myh4 UTSW 11 67250768 missense probably benign 0.01
R2848:Myh4 UTSW 11 67248633 missense probably benign 0.20
R3111:Myh4 UTSW 11 67246450 missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67255315 missense probably damaging 1.00
R3845:Myh4 UTSW 11 67259105 missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67257183 missense probably benign 0.00
R4498:Myh4 UTSW 11 67251752 missense probably damaging 1.00
R4514:Myh4 UTSW 11 67255569 missense probably benign 0.06
R4601:Myh4 UTSW 11 67250310 missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67246401 missense probably benign 0.02
R4684:Myh4 UTSW 11 67245811 missense probably damaging 0.99
R4736:Myh4 UTSW 11 67240920 missense probably benign 0.01
R4837:Myh4 UTSW 11 67258992 missense probably benign 0.38
R4866:Myh4 UTSW 11 67248627 missense probably benign 0.00
R4869:Myh4 UTSW 11 67252664 missense probably damaging 1.00
R4887:Myh4 UTSW 11 67241054 missense probably damaging 0.99
R4921:Myh4 UTSW 11 67254028 missense probably damaging 1.00
R5005:Myh4 UTSW 11 67253415 missense probably benign 0.05
R5008:Myh4 UTSW 11 67253532 missense probably benign 0.00
R5011:Myh4 UTSW 11 67256363 missense probably benign 0.03
R5087:Myh4 UTSW 11 67255409 missense probably damaging 1.00
R5277:Myh4 UTSW 11 67252354 missense probably damaging 1.00
R5336:Myh4 UTSW 11 67259191 splice site probably null
R5354:Myh4 UTSW 11 67255725 missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67259324 missense probably damaging 1.00
R5484:Myh4 UTSW 11 67251818 missense probably damaging 1.00
R5774:Myh4 UTSW 11 67253208 nonsense probably null
R5902:Myh4 UTSW 11 67250907 missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67259300 missense probably damaging 0.99
R6045:Myh4 UTSW 11 67244724 missense probably benign 0.32
R6156:Myh4 UTSW 11 67250792 missense probably benign 0.00
R6318:Myh4 UTSW 11 67243442 missense probably benign 0.02
R6352:Myh4 UTSW 11 67252282 missense probably damaging 1.00
R6385:Myh4 UTSW 11 67255837 missense probably damaging 1.00
R6493:Myh4 UTSW 11 67258629 missense probably benign 0.16
R6666:Myh4 UTSW 11 67251812 missense probably damaging 1.00
R6826:Myh4 UTSW 11 67246531 missense probably damaging 1.00
R6852:Myh4 UTSW 11 67252968 splice site probably null
R6857:Myh4 UTSW 11 67249885 missense possibly damaging 0.74
R7029:Myh4 UTSW 11 67246425 missense probably benign 0.40
R7076:Myh4 UTSW 11 67253173 missense possibly damaging 0.85
R7145:Myh4 UTSW 11 67260228 missense possibly damaging 0.54
X0027:Myh4 UTSW 11 67246480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGCTCCCCTGGGAAATC -3'
(R):5'- TTCCCCAGTTGTAAGTCCCAG -3'

Sequencing Primer
(F):5'- TCCCCTGGGAAATCAGAATTCTGG -3'
(R):5'- AGTTGTAAGTCCCAGGTCCG -3'
Posted On2018-04-02