Incidental Mutation 'R6301:Sgca'
ID509114
Institutional Source Beutler Lab
Gene Symbol Sgca
Ensembl Gene ENSMUSG00000001508
Gene Namesarcoglycan, alpha (dystrophin-associated glycoprotein)
Synonyms50DAG, adhalin, Asg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R6301 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94962791-94976327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 94972567 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 28 (L28V)
Ref Sequence ENSEMBL: ENSMUSP00000118455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038928] [ENSMUST00000100551] [ENSMUST00000103162] [ENSMUST00000139855] [ENSMUST00000152042] [ENSMUST00000166320]
Predicted Effect probably benign
Transcript: ENSMUST00000038928
SMART Domains Protein: ENSMUSP00000039866
Gene: ENSMUSG00000038994

DomainStartEndE-ValueType
Pfam:Linker_histone 35 106 5.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100551
AA Change: L28V

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098118
Gene: ENSMUSG00000001508
AA Change: L28V

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103162
AA Change: L28V

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099451
Gene: ENSMUSG00000001508
AA Change: L28V

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139855
SMART Domains Protein: ENSMUSP00000117637
Gene: ENSMUSG00000001508

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 1 140 2.1e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152042
AA Change: L28V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118455
Gene: ENSMUSG00000001508
AA Change: L28V

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 6 100 5.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166320
AA Change: L28V

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130617
Gene: ENSMUSG00000001508
AA Change: L28V

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Meta Mutation Damage Score 0.0272 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the sarcoglycan alpha/epsilon family of transmembrane proteins. The encoded protein is part of the dystrophin-glycoprotein complex which links the extracellular matrix to the cytoskeleton in muscle fibers. Disruption of this gene results in progressive muscular dystrophy and is associated with the development of embryonal rhabdomysarcoma. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mutation of this gene results in muscle abnormalities, with decreased skeletal muscle force and stiffness and muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot10 T C 15: 20,666,262 N131S probably benign Het
Agbl5 A G 5: 30,891,833 Y220C probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ap3b1 A T 13: 94,528,295 Q914L unknown Het
Arhgef25 T C 10: 127,185,882 D216G possibly damaging Het
Bcas2 T A 3: 103,171,871 probably benign Het
Bpifb5 A C 2: 154,230,219 H282P possibly damaging Het
Ccdc167 A G 17: 29,705,582 I15T probably damaging Het
Cd248 A G 19: 5,069,981 N619S probably benign Het
Chrna1 A G 2: 73,570,484 F234S possibly damaging Het
Clcc1 T G 3: 108,673,366 M332R probably damaging Het
Cmklr1 T A 5: 113,614,938 M1L possibly damaging Het
Cntnap5c A G 17: 57,892,037 M109V probably benign Het
Coq2 A G 5: 100,661,863 I18T possibly damaging Het
Crybg3 T C 16: 59,530,338 S880G probably damaging Het
Cubn A G 2: 13,478,078 C286R probably damaging Het
Defa24 T C 8: 21,735,283 V63A probably benign Het
Dnah6 C T 6: 73,086,217 R2634H probably damaging Het
Dusp8 T A 7: 142,083,019 probably null Het
Elac1 T C 18: 73,738,868 D352G probably damaging Het
Ermap A T 4: 119,185,603 V241E probably damaging Het
Fgf10 T A 13: 118,715,511 M43K probably benign Het
Gabrd A G 4: 155,387,267 V193A probably damaging Het
Gm13124 C T 4: 144,558,654 A138T probably damaging Het
Gm6588 A T 5: 112,450,468 I294F possibly damaging Het
Gm884 A T 11: 103,618,930 probably benign Het
Hectd4 T G 5: 121,254,220 C182W possibly damaging Het
Hook3 C T 8: 26,034,940 W26* probably null Het
Kif1a C A 1: 93,054,941 E714* probably null Het
Krt6b T C 15: 101,678,951 E236G probably damaging Het
Large2 A G 2: 92,369,516 L209P probably damaging Het
Lats1 A G 10: 7,703,107 N665S probably benign Het
Lrrtm3 T C 10: 64,089,222 I55M probably benign Het
Ltk A G 2: 119,751,757 S838P probably damaging Het
Ltn1 T C 16: 87,420,306 I348V probably benign Het
Mag T A 7: 30,900,679 S559C probably damaging Het
Mink1 A G 11: 70,612,294 H1072R possibly damaging Het
Mycbp2 T A 14: 103,155,426 Q833L probably damaging Het
Myh4 G A 11: 67,255,333 E1406K possibly damaging Het
Npc1 C T 18: 12,197,245 V950I probably benign Het
Npl A G 1: 153,518,881 probably null Het
Olfr1493-ps1 A G 19: 13,726,389 I43V probably benign Het
Olfr165 A T 16: 19,407,417 F200I possibly damaging Het
Olfr743 T A 14: 50,534,254 F281I probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxsm A T 14: 16,242,220 I183N probably damaging Het
Pde7a T C 3: 19,243,163 I108V probably benign Het
Pgghg A T 7: 140,946,376 T585S probably damaging Het
Pkhd1l1 G A 15: 44,589,525 D3949N probably damaging Het
Ralgapa2 A T 2: 146,327,411 H1777Q possibly damaging Het
Rela G A 19: 5,645,410 probably null Het
Rilpl1 C A 5: 124,514,539 G41W probably damaging Het
Rp1 T C 1: 4,347,254 K1212E probably benign Het
Ssmem1 A G 6: 30,519,759 R148G probably damaging Het
St8sia5 A T 18: 77,246,140 N165Y probably damaging Het
Tbl2 A T 5: 135,159,369 H339L probably benign Het
Tcof1 G A 18: 60,828,825 P718L probably damaging Het
Trim72 A T 7: 128,004,614 E44V possibly damaging Het
Try10 T A 6: 41,355,589 S60T probably benign Het
Usp31 A T 7: 121,648,276 S1315T possibly damaging Het
Xrn2 A G 2: 147,063,342 I856V probably benign Het
Other mutations in Sgca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Sgca APN 11 94972287 missense probably damaging 1.00
IGL01479:Sgca APN 11 94963378 nonsense probably null
IGL02153:Sgca APN 11 94963284 missense probably damaging 1.00
IGL02713:Sgca APN 11 94971305 missense probably damaging 1.00
IGL02928:Sgca APN 11 94972303 missense probably damaging 1.00
IGL03185:Sgca APN 11 94970784 missense probably benign 0.00
R0602:Sgca UTSW 11 94963235 missense possibly damaging 0.94
R0834:Sgca UTSW 11 94970686 nonsense probably null
R1547:Sgca UTSW 11 94969433 missense probably damaging 1.00
R1703:Sgca UTSW 11 94969391 missense probably damaging 0.97
R4110:Sgca UTSW 11 94972570 missense possibly damaging 0.63
R4112:Sgca UTSW 11 94972570 missense possibly damaging 0.63
R4796:Sgca UTSW 11 94970727 unclassified probably null
R5301:Sgca UTSW 11 94963331 missense probably damaging 1.00
R6347:Sgca UTSW 11 94972028 missense probably damaging 1.00
R6510:Sgca UTSW 11 94963232 missense probably benign 0.36
R7110:Sgca UTSW 11 94963401 critical splice acceptor site probably null
R7121:Sgca UTSW 11 94969547 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGCCAGGGTTATAGGGACTG -3'
(R):5'- AGAAGTCTGGGTCCTGTCAC -3'

Sequencing Primer
(F):5'- TGTGTAGTGCAGCCACCTG -3'
(R):5'- AGCAGAGTAGGATCTATACCCC -3'
Posted On2018-04-02