Incidental Mutation 'R6303:5330417C22Rik'
ID509143
Institutional Source Beutler Lab
Gene Symbol 5330417C22Rik
Ensembl Gene ENSMUSG00000040412
Gene NameRIKEN cDNA 5330417C22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6303 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108455694-108536536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108461256 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 806 (C806W)
Ref Sequence ENSEMBL: ENSMUSP00000102237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048012] [ENSMUST00000106625] [ENSMUST00000106626] [ENSMUST00000185128]
Predicted Effect probably damaging
Transcript: ENSMUST00000048012
AA Change: C754W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040128
Gene: ENSMUSG00000040412
AA Change: C754W

DomainStartEndE-ValueType
internal_repeat_1 3 212 1.11e-6 PROSPERO
internal_repeat_1 289 522 1.11e-6 PROSPERO
transmembrane domain 806 828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106625
AA Change: C856W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102236
Gene: ENSMUSG00000040412
AA Change: C856W

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 310 8.31e-11 PROSPERO
internal_repeat_1 325 620 8.31e-11 PROSPERO
transmembrane domain 904 926 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106626
AA Change: C806W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102237
Gene: ENSMUSG00000040412
AA Change: C806W

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 178 2.5e-7 PROSPERO
internal_repeat_1 275 421 2.5e-7 PROSPERO
transmembrane domain 854 876 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140357
Predicted Effect probably benign
Transcript: ENSMUST00000185128
SMART Domains Protein: ENSMUSP00000138870
Gene: ENSMUSG00000040412

DomainStartEndE-ValueType
low complexity region 25 31 N/A INTRINSIC
Meta Mutation Damage Score 0.0308 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Expression of this gene is induced by estrogen and the encoded protein has been characterized as a transmembrane protein. The encoded protein has been found in to correlate with survival in certain carcinomas (PMID: 21102415) and may be important for cellular response to stress (PMID: 21072319). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Male homozygous mice are infertile. Microscopic analysis revealed defective spermatogenesis in the testis, and hypospermia and defective spermatozoa in the epididymides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,290,368 K2269N possibly damaging Het
Apol9b T A 15: 77,735,304 V100E probably damaging Het
Bin3 A G 14: 70,137,176 D218G possibly damaging Het
Cobll1 A T 2: 65,098,033 M982K possibly damaging Het
Crybg2 T C 4: 134,087,587 V1593A possibly damaging Het
Ctsh A G 9: 90,062,743 S76G possibly damaging Het
Dnajc10 T G 2: 80,350,664 D767E probably benign Het
Etaa1 A C 11: 17,947,505 M204R probably damaging Het
Fbxw16 A T 9: 109,449,101 I3N probably benign Het
Fndc1 T C 17: 7,758,485 E1394G probably damaging Het
Gm19410 T C 8: 35,807,560 C1512R possibly damaging Het
Gramd4 A G 15: 86,134,919 E596G possibly damaging Het
Hephl1 C A 9: 15,090,152 V226F possibly damaging Het
Ilf3 G A 9: 21,403,136 probably benign Het
Kcnh3 T C 15: 99,227,038 V123A probably benign Het
Kdm2b A G 5: 122,881,744 S260P probably benign Het
Lingo4 G A 3: 94,403,206 G484R probably damaging Het
Lrrc10b T C 19: 10,456,978 Q113R probably benign Het
Lrrc8c A T 5: 105,608,609 N750I probably benign Het
Nlrp2 A G 7: 5,337,761 L18P probably damaging Het
Nrp2 T C 1: 62,745,406 L238P probably damaging Het
Nup155 T C 15: 8,118,042 S262P probably damaging Het
Olfr639 G A 7: 104,012,031 L224F probably damaging Het
Pappa G A 4: 65,204,654 G742D probably damaging Het
Pclo A T 5: 14,677,893 probably benign Het
Phyhipl A G 10: 70,559,557 probably null Het
Plcg1 A G 2: 160,761,463 T1185A possibly damaging Het
Plscr5 A T 9: 92,205,556 I193F probably benign Het
Polr1b G A 2: 129,115,762 R579H probably damaging Het
Polr2a A T 11: 69,746,913 W202R probably damaging Het
Ppp4r1 A G 17: 65,824,729 K489E probably benign Het
Qser1 G A 2: 104,762,830 T1704I probably damaging Het
Sik1 A G 17: 31,846,296 V776A probably damaging Het
Soga1 T C 2: 157,040,764 N456S possibly damaging Het
Spice1 A G 16: 44,370,697 M305V probably benign Het
Taf4b T C 18: 14,807,355 I297T probably damaging Het
Trim14 C A 4: 46,522,118 M186I probably benign Het
Usp49 C A 17: 47,680,822 Q670K probably damaging Het
Usp54 T C 14: 20,560,968 D1260G possibly damaging Het
Vmn1r224 T A 17: 20,419,766 S202T possibly damaging Het
Vmn1r3 T A 4: 3,184,975 T111S probably damaging Het
Zfp985 A G 4: 147,583,775 I367V probably benign Het
Other mutations in 5330417C22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:5330417C22Rik APN 3 108481312 missense possibly damaging 0.48
IGL02079:5330417C22Rik APN 3 108481359 missense possibly damaging 0.91
IGL02268:5330417C22Rik APN 3 108467797 missense probably benign 0.00
IGL02869:5330417C22Rik APN 3 108472866 missense probably benign 0.34
IGL02891:5330417C22Rik APN 3 108464392 missense probably benign 0.03
IGL03088:5330417C22Rik APN 3 108536358 missense probably damaging 1.00
IGL03345:5330417C22Rik APN 3 108492016 missense possibly damaging 0.68
IGL03398:5330417C22Rik APN 3 108461221 missense possibly damaging 0.94
IGL03138:5330417C22Rik UTSW 3 108471993 missense probably benign 0.08
R0325:5330417C22Rik UTSW 3 108461251 missense probably damaging 1.00
R0730:5330417C22Rik UTSW 3 108469535 missense probably benign 0.00
R0844:5330417C22Rik UTSW 3 108480963 splice site probably benign
R1646:5330417C22Rik UTSW 3 108462990 missense probably damaging 1.00
R1666:5330417C22Rik UTSW 3 108469997 missense probably benign 0.01
R1726:5330417C22Rik UTSW 3 108467868 missense possibly damaging 0.67
R2202:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2203:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2204:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2205:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2249:5330417C22Rik UTSW 3 108471410 nonsense probably null
R2443:5330417C22Rik UTSW 3 108481349 missense probably damaging 1.00
R3965:5330417C22Rik UTSW 3 108458449 missense probably damaging 1.00
R4171:5330417C22Rik UTSW 3 108460943 missense probably benign 0.30
R4785:5330417C22Rik UTSW 3 108458227 utr 3 prime probably benign
R4810:5330417C22Rik UTSW 3 108470011 splice site probably benign
R4862:5330417C22Rik UTSW 3 108467833 missense probably benign
R4923:5330417C22Rik UTSW 3 108471968 critical splice donor site probably null
R5040:5330417C22Rik UTSW 3 108475001 missense probably damaging 1.00
R5153:5330417C22Rik UTSW 3 108472747 missense possibly damaging 0.75
R5405:5330417C22Rik UTSW 3 108467786 nonsense probably null
R5609:5330417C22Rik UTSW 3 108471415 missense probably damaging 0.96
R5663:5330417C22Rik UTSW 3 108492083 missense probably benign 0.00
R6194:5330417C22Rik UTSW 3 108465779 missense probably benign 0.05
R6304:5330417C22Rik UTSW 3 108461256 missense probably damaging 1.00
R6381:5330417C22Rik UTSW 3 108481814 missense possibly damaging 0.52
R6676:5330417C22Rik UTSW 3 108469915 missense probably damaging 1.00
R6852:5330417C22Rik UTSW 3 108482338 missense probably damaging 1.00
X0022:5330417C22Rik UTSW 3 108459746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTTTTGCAGATGGTAACTCTC -3'
(R):5'- CATCTGAGTTAAGGACAGGTTGG -3'

Sequencing Primer
(F):5'- CAGATGGTAACTCTCTGCTCAGG -3'
(R):5'- TTAAGGACAGGTTGGGGGAG -3'
Posted On2018-04-02