Incidental Mutation 'R6288:Bean1'
ID 509237
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Name brain expressed, associated with Nedd4, 1
Synonyms
MMRRC Submission 044458-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6288 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 104897110-104945730 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104937622 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 33 (L33Q)
Ref Sequence ENSEMBL: ENSMUSP00000131530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
AlphaFold Q9EQG5
Predicted Effect probably damaging
Transcript: ENSMUST00000093245
AA Change: L33Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872
AA Change: L33Q

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164076
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167633
AA Change: L33Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872
AA Change: L33Q

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171018
AA Change: L67Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872
AA Change: L67Q

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212979
AA Change: L67Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000213077
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G T 11: 58,184,421 (GRCm39) D380Y probably damaging Het
4931406B18Rik T A 7: 43,147,549 (GRCm39) E274V probably damaging Het
Ankrd44 A G 1: 54,802,922 (GRCm39) L192P probably damaging Het
Apbb1 T A 7: 105,208,434 (GRCm39) I624F probably damaging Het
Asxl2 A G 12: 3,526,040 (GRCm39) K219E possibly damaging Het
Cdhr17 T A 5: 17,061,283 (GRCm39) C738S possibly damaging Het
Col22a1 T C 15: 71,766,718 (GRCm39) probably null Het
Col6a4 T C 9: 105,945,462 (GRCm39) D884G probably damaging Het
Crocc2 A G 1: 93,122,227 (GRCm39) R707G probably benign Het
Cts7 C T 13: 61,500,584 (GRCm39) G321E probably damaging Het
Cyp2d9 C T 15: 82,340,616 (GRCm39) H422Y probably damaging Het
Epha2 C T 4: 141,044,344 (GRCm39) A382V probably benign Het
Fam151a A C 4: 106,605,341 (GRCm39) T568P probably damaging Het
Fbln2 A T 6: 91,210,263 (GRCm39) Y69F probably damaging Het
Flg2 A T 3: 93,111,092 (GRCm39) H1040L unknown Het
Gucy2g T C 19: 55,215,945 (GRCm39) T476A probably benign Het
H3c7 A G 13: 23,728,664 (GRCm39) T4A probably benign Het
Ighv1-20 C T 12: 114,687,519 (GRCm39) G75D probably benign Het
Inpp5b G A 4: 124,679,020 (GRCm39) V476I probably benign Het
Nrxn2 T A 19: 6,540,591 (GRCm39) L855Q probably damaging Het
Or52ab2 A G 7: 102,970,286 (GRCm39) I223V probably damaging Het
Or8h7 A G 2: 86,721,226 (GRCm39) F98L probably benign Het
Pcolce2 T A 9: 95,563,646 (GRCm39) Y211N probably damaging Het
Phf21b A C 15: 84,739,272 (GRCm39) probably benign Het
Rbm8a2 T C 1: 175,806,111 (GRCm39) E122G probably benign Het
Rimbp3 C T 16: 17,030,772 (GRCm39) P1399S probably benign Het
Slc38a1 A G 15: 96,484,759 (GRCm39) V267A probably benign Het
Sox11 A G 12: 27,392,332 (GRCm39) F26L possibly damaging Het
Ssbp3 T A 4: 106,903,277 (GRCm39) probably null Het
Trim12c C T 7: 103,995,936 (GRCm39) V146I probably benign Het
Trrap C A 5: 144,748,802 (GRCm39) T1543K probably damaging Het
Zfp473 C A 7: 44,382,958 (GRCm39) K457N probably damaging Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104,937,550 (GRCm39) missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104,943,807 (GRCm39) missense probably damaging 1.00
R0490:Bean1 UTSW 8 104,941,660 (GRCm39) missense possibly damaging 0.76
R1319:Bean1 UTSW 8 104,943,856 (GRCm39) missense probably benign
R1920:Bean1 UTSW 8 104,937,742 (GRCm39) missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104,908,643 (GRCm39) missense probably benign 0.04
R3980:Bean1 UTSW 8 104,937,730 (GRCm39) missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104,940,566 (GRCm39) start codon destroyed probably null 0.04
R4369:Bean1 UTSW 8 104,943,742 (GRCm39) missense probably damaging 1.00
R4516:Bean1 UTSW 8 104,941,786 (GRCm39) missense probably damaging 1.00
R4542:Bean1 UTSW 8 104,937,591 (GRCm39) missense probably damaging 1.00
R4663:Bean1 UTSW 8 104,937,799 (GRCm39) missense probably damaging 1.00
R4962:Bean1 UTSW 8 104,943,606 (GRCm39) missense probably damaging 1.00
R5221:Bean1 UTSW 8 104,941,784 (GRCm39) missense probably damaging 1.00
R6588:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R6615:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R6994:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7359:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7451:Bean1 UTSW 8 104,940,628 (GRCm39) missense probably benign 0.01
R7454:Bean1 UTSW 8 104,937,658 (GRCm39) missense probably damaging 1.00
R7473:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7826:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8034:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8418:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8789:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8885:Bean1 UTSW 8 104,908,752 (GRCm39) critical splice donor site probably null
R8888:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8892:Bean1 UTSW 8 104,943,610 (GRCm39) missense probably damaging 1.00
R8896:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8992:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9015:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9113:Bean1 UTSW 8 104,940,557 (GRCm39) missense probably benign 0.00
R9122:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9135:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9151:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9255:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9340:Bean1 UTSW 8 104,908,739 (GRCm39) missense probably damaging 0.99
R9363:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9417:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9566:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9731:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
RF054:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGCCTGACCCTGACTATCCTC -3'
(R):5'- TGGCAGAAGTAGCATGACTCAG -3'

Sequencing Primer
(F):5'- CCACTTATTTAGAGACAAATGACTCC -3'
(R):5'- ATGACTCAGAGCTCACCGTATTC -3'
Posted On 2018-04-02