Incidental Mutation 'R6302:Olfr686'
ID509279
Institutional Source Beutler Lab
Gene Symbol Olfr686
Ensembl Gene ENSMUSG00000048425
Gene Nameolfactory receptor 686
SynonymsGA_x6K02T2PBJ9-7832633-7831680, MOR35-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6302 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105201858-105207485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105203719 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 208 (L208H)
Ref Sequence ENSEMBL: ENSMUSP00000148898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050157] [ENSMUST00000214147] [ENSMUST00000216143] [ENSMUST00000216613]
Predicted Effect probably damaging
Transcript: ENSMUST00000050157
AA Change: L208H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049601
Gene: ENSMUSG00000048425
AA Change: L208H

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 8e-92 PFAM
Pfam:7TM_GPCR_Srsx 37 229 3e-9 PFAM
Pfam:7tm_1 43 294 9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214147
AA Change: L208H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216143
AA Change: L208H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216613
AA Change: L208H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T G 9: 107,929,573 V365G probably benign Het
Adgrg6 T A 10: 14,441,483 D531V probably benign Het
Ankrd11 A G 8: 122,889,989 S2354P probably benign Het
Ano9 A T 7: 141,104,308 W514R probably damaging Het
Arfgef3 A T 10: 18,652,841 V266E probably damaging Het
Bahcc1 T C 11: 120,276,808 I1345T probably damaging Het
BC067074 A G 13: 113,368,112 D1925G probably damaging Het
Bpifb4 G A 2: 153,959,667 M355I probably benign Het
Catsperb T C 12: 101,588,143 S699P possibly damaging Het
Cdh23 T G 10: 60,305,093 I3161L possibly damaging Het
Chd3 T C 11: 69,353,778 T1257A probably damaging Het
Cnnm4 C T 1: 36,499,955 T638I probably benign Het
Cyp26c1 A G 19: 37,686,488 T86A probably damaging Het
Cyp3a63-ps A G 5: 145,628,037 noncoding transcript Het
Dnah14 T A 1: 181,601,206 I259N possibly damaging Het
Dnah17 T C 11: 118,129,155 D22G probably benign Het
Epn2 T G 11: 61,546,486 T87P probably damaging Het
Fbxl18 A G 5: 142,888,823 L81P probably damaging Het
Gas1 A T 13: 60,176,156 D221E probably damaging Het
Gm436 G T 4: 144,670,190 S324* probably null Het
Gm8356 T C 14: 6,535,128 Y130C probably damaging Het
Gpr151 T G 18: 42,579,394 K73T probably damaging Het
Helq A C 5: 100,798,439 V12G probably damaging Het
Inpp4b A G 8: 81,768,177 T74A probably benign Het
Kirrel3 G A 9: 35,007,749 V234I probably damaging Het
Kxd1 T A 8: 70,520,063 probably null Het
Lif T C 11: 4,268,924 Y68H probably damaging Het
Map6 A G 7: 99,336,107 Q406R probably damaging Het
Mcoln3 A T 3: 146,124,772 M86L probably benign Het
Mei1 T A 15: 82,103,238 Y834* probably null Het
Mroh1 T C 15: 76,436,119 probably null Het
Myo15b T C 11: 115,886,239 I2319T possibly damaging Het
Myo7b T G 18: 31,994,386 D621A probably damaging Het
Naip5 C T 13: 100,223,166 A521T possibly damaging Het
Nek7 T C 1: 138,498,613 D254G probably damaging Het
Nsd2 A G 5: 33,867,577 R560G possibly damaging Het
Olfr325 T C 11: 58,581,638 F265L probably benign Het
Pbx1 T A 1: 168,191,341 T312S probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pitrm1 A G 13: 6,560,061 S390G probably damaging Het
Plcxd3 C T 15: 4,516,757 T81M probably damaging Het
Pmf1 C T 3: 88,399,710 probably null Het
Rabep1 T C 11: 70,935,121 V739A probably damaging Het
Rex2 A G 4: 147,057,994 D313G possibly damaging Het
Rpia C T 6: 70,773,501 V216I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sec13 T A 6: 113,735,206 H56L probably damaging Het
Sec16a A T 2: 26,425,805 V1733D probably damaging Het
Sim2 G A 16: 94,097,230 A108T probably damaging Het
Slc27a5 T C 7: 12,988,552 D665G probably damaging Het
Slc38a6 T A 12: 73,337,075 V180E probably damaging Het
Smarcad1 T G 6: 65,075,138 N38K possibly damaging Het
Spem2 T C 11: 69,818,265 T45A possibly damaging Het
Svil T C 18: 5,057,432 S714P probably benign Het
Taar7b T A 10: 24,000,260 S108T possibly damaging Het
Tbl3 T C 17: 24,704,671 K256E probably benign Het
Tcam1 T G 11: 106,286,450 C423G probably damaging Het
Trpm4 A T 7: 45,327,719 probably null Het
Ttyh2 T C 11: 114,701,836 C231R probably damaging Het
Ugt3a2 C T 15: 9,365,311 P337S probably damaging Het
Vmn2r83 A C 10: 79,469,003 T16P possibly damaging Het
Vps52 T C 17: 33,963,215 F589S probably damaging Het
Xkr4 T C 1: 3,216,738 T410A probably damaging Het
Xkr9 A G 1: 13,672,502 T4A probably damaging Het
Yars2 T C 16: 16,304,574 L268P probably damaging Het
Zbtb41 C A 1: 139,429,289 N427K possibly damaging Het
Zeb2 T C 2: 44,997,759 T414A probably benign Het
Other mutations in Olfr686
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Olfr686 APN 7 105203906 missense probably benign 0.01
R0112:Olfr686 UTSW 7 105203659 missense probably benign 0.05
R0234:Olfr686 UTSW 7 105203614 missense probably damaging 1.00
R0234:Olfr686 UTSW 7 105203614 missense probably damaging 1.00
R0541:Olfr686 UTSW 7 105204160 missense probably damaging 0.99
R0771:Olfr686 UTSW 7 105204161 missense possibly damaging 0.91
R3944:Olfr686 UTSW 7 105203955 nonsense probably null
R4079:Olfr686 UTSW 7 105204021 missense probably damaging 1.00
R4929:Olfr686 UTSW 7 105204025 missense probably damaging 1.00
R4978:Olfr686 UTSW 7 105204191 missense probably benign 0.02
R6267:Olfr686 UTSW 7 105203392 missense probably damaging 1.00
R6483:Olfr686 UTSW 7 105204293 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCTGCATGACCACAGAAAG -3'
(R):5'- TCTGTAACCCATTGCATTATGC -3'

Sequencing Primer
(F):5'- CACAGAAAGAAAGCCAGGTCCATAG -3'
(R):5'- ACGCCTGAAGTTGTTGCCAAG -3'
Posted On2018-04-02