Incidental Mutation 'R6319:Mnd1'
ID509328
Institutional Source Beutler Lab
Gene Symbol Mnd1
Ensembl Gene ENSMUSG00000033752
Gene Namemeiotic nuclear divisions 1
Synonyms2610034E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6319 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location84087933-84155786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84141764 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000048262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047368]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047368
AA Change: S2P

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048262
Gene: ENSMUSG00000033752
AA Change: S2P

DomainStartEndE-ValueType
Pfam:Penicillinase_R 10 129 6.9e-8 PFAM
Pfam:Mnd1 16 202 1.7e-76 PFAM
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of the MND1 gene associates with HOP2 (MIM 608665) to form a stable heterodimeric complex that binds DNA and stimulates the recombinase activity of RAD51 (MIM 179617) and DMC1 (MIM 602721) (Chi et al., 2007 [PubMed 17639080]). Both the MND1 and HOP2 genes are indispensable for meiotic recombination.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants for this allele display defects in homologous chromosome synapsis and double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Abcg2 T C 6: 58,674,738 S372P probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Bmp6 A T 13: 38,346,414 H161L probably benign Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dcaf13 A G 15: 39,143,672 T334A probably benign Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Enpp1 T C 10: 24,648,031 Y747C probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Grik4 A T 9: 42,566,336 M518K probably damaging Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kcnn4 T A 7: 24,381,740 M301K possibly damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr146 A G 9: 39,019,514 V9A probably damaging Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Plekhm3 A T 1: 64,921,934 Y388N probably benign Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Unc5b G A 10: 60,778,801 A239V probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Mnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Mnd1 APN 3 84138198 missense possibly damaging 0.95
IGL01355:Mnd1 APN 3 84116477 missense probably benign 0.00
IGL02413:Mnd1 APN 3 84116479 missense probably benign
IGL03303:Mnd1 APN 3 84104937 missense probably benign 0.00
trinidad UTSW 3 84134109 missense probably benign 0.30
R0569:Mnd1 UTSW 3 84104979 missense probably benign 0.36
R1564:Mnd1 UTSW 3 84116431 missense probably benign 0.41
R2208:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2211:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2964:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2965:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R3106:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R5496:Mnd1 UTSW 3 84088174 missense probably damaging 1.00
X0026:Mnd1 UTSW 3 84093558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGTCTCTAACAAAACAGACC -3'
(R):5'- TGAGAGTGACAAGCCTGTTG -3'

Sequencing Primer
(F):5'- CAGACCATTGACATTGACTTACAC -3'
(R):5'- GGAACTCACTTTGTCGACCAG -3'
Posted On2018-04-02