Incidental Mutation 'R6319:Abcg2'
ID509333
Institutional Source Beutler Lab
Gene Symbol Abcg2
Ensembl Gene ENSMUSG00000029802
Gene NameATP binding cassette subfamily G member 2 (Junior blood group)
SynonymsBcrp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6319 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location58584523-58695676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58674738 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 372 (S372P)
Ref Sequence ENSEMBL: ENSMUSP00000109933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031822] [ENSMUST00000114294] [ENSMUST00000143752] [ENSMUST00000203146]
Predicted Effect probably benign
Transcript: ENSMUST00000031822
AA Change: S372P

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031822
Gene: ENSMUSG00000029802
AA Change: S372P

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 5.4e-42 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114294
AA Change: S372P

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109933
Gene: ENSMUSG00000029802
AA Change: S372P

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 1.2e-40 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134426
Predicted Effect probably benign
Transcript: ENSMUST00000143752
AA Change: S372P

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138608
Gene: ENSMUSG00000029802
AA Change: S372P

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 573 7.2e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000145685
AA Change: S57P
Predicted Effect probably benign
Transcript: ENSMUST00000203146
SMART Domains Protein: ENSMUSP00000145435
Gene: ENSMUSG00000029802

DomainStartEndE-ValueType
SCOP:d1jj7a_ 33 129 7e-8 SMART
Blast:AAA 71 125 3e-32 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, the human protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. This protein likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit extreme sensitivity to the dietary chlorophyll-catabolite pheophorbide a, resulting in severe phototoxic skin lesions upon light exposure. Mutants show a novel form of protoporphyria, associated with a 10-fold increase in erythrocyte levels of protoporphyrin IX. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,685,401 R233C probably benign Het
Adam34 A G 8: 43,651,915 I231T probably benign Het
Adgrg6 T A 10: 14,431,622 H840L probably damaging Het
Akap11 T C 14: 78,513,538 T470A probably benign Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
B430306N03Rik A T 17: 48,316,743 Q24L probably damaging Het
Bmp6 A T 13: 38,346,414 H161L probably benign Het
Cdca8 C A 4: 124,921,294 D177Y possibly damaging Het
Col14a1 A G 15: 55,516,169 T1693A probably damaging Het
Cpsf1 A G 15: 76,596,967 S1230P probably damaging Het
Dcaf13 A G 15: 39,143,672 T334A probably benign Het
Dhx32 A C 7: 133,737,226 V360G probably damaging Het
Dmxl1 A G 18: 49,852,300 T205A probably benign Het
Dxo A G 17: 34,838,391 E253G probably damaging Het
Enpp1 T C 10: 24,648,031 Y747C probably damaging Het
Gga2 T C 7: 122,002,166 E238G possibly damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Grik4 A T 9: 42,566,336 M518K probably damaging Het
Igf2r T A 17: 12,714,113 S841C probably damaging Het
Itfg1 G T 8: 85,840,629 T37K probably damaging Het
Kcnn4 T A 7: 24,381,740 M301K possibly damaging Het
Kel C A 6: 41,702,447 E127D probably benign Het
Lrp4 A G 2: 91,480,321 Y569C probably damaging Het
Lrp6 A T 6: 134,541,835 V89D possibly damaging Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Mnd1 A G 3: 84,141,764 S2P possibly damaging Het
Neb T A 2: 52,163,011 probably null Het
Olfr146 A G 9: 39,019,514 V9A probably damaging Het
Olfr191 A G 16: 59,086,021 I154T probably benign Het
Olfr609 T C 7: 103,492,725 E51G possibly damaging Het
Pcca G A 14: 122,582,623 V60M probably damaging Het
Plekhm3 A T 1: 64,921,934 Y388N probably benign Het
Prr18 G T 17: 8,341,311 V100F probably damaging Het
Rnf25 T C 1: 74,595,731 Y44C probably damaging Het
Smg6 T C 11: 75,156,222 L1247P probably damaging Het
Tdh T C 14: 63,495,737 T137A probably benign Het
Tmem200a A G 10: 25,993,495 V292A probably damaging Het
Ubr3 T C 2: 69,973,414 V1116A probably benign Het
Ubr4 G A 4: 139,408,889 E942K possibly damaging Het
Unc5b G A 10: 60,778,801 A239V probably damaging Het
Vill G C 9: 119,063,648 Q376H probably benign Het
Vmn2r115 A G 17: 23,347,903 E463G possibly damaging Het
Other mutations in Abcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01489:Abcg2 APN 6 58685823 critical splice donor site probably null
IGL01654:Abcg2 APN 6 58683321 critical splice donor site probably null
IGL02646:Abcg2 APN 6 58685696 missense probably benign 0.01
IGL03342:Abcg2 APN 6 58665135 missense probably damaging 1.00
PIT4519001:Abcg2 UTSW 6 58674807 missense probably damaging 0.99
R0092:Abcg2 UTSW 6 58685777 missense probably benign 0.14
R0313:Abcg2 UTSW 6 58672097 missense probably benign
R0742:Abcg2 UTSW 6 58678326 missense probably benign 0.00
R1165:Abcg2 UTSW 6 58678300 missense probably benign 0.21
R1302:Abcg2 UTSW 6 58685817 missense probably damaging 1.00
R1476:Abcg2 UTSW 6 58678337 missense probably benign 0.06
R1523:Abcg2 UTSW 6 58685694 missense possibly damaging 0.96
R2056:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2057:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2153:Abcg2 UTSW 6 58684322 splice site probably null
R5636:Abcg2 UTSW 6 58672056 missense probably damaging 0.98
R5723:Abcg2 UTSW 6 58678351 nonsense probably null
R5972:Abcg2 UTSW 6 58672085 missense probably benign 0.00
R6896:Abcg2 UTSW 6 58683313 missense probably damaging 1.00
R7136:Abcg2 UTSW 6 58684340 missense possibly damaging 0.67
R7387:Abcg2 UTSW 6 58689624 missense possibly damaging 0.67
X0028:Abcg2 UTSW 6 58678276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAGACTGAAGAGCCTTCC -3'
(R):5'- CCATGTCTGGTTATATGCCAAGTC -3'

Sequencing Primer
(F):5'- CTGAAGAGCCTTCCAAGGG -3'
(R):5'- GGCTGTATAGAGAAACCCTGTCTC -3'
Posted On2018-04-02