Incidental Mutation 'R6329:Dnajc25'
ID509381
Institutional Source Beutler Lab
Gene Symbol Dnajc25
Ensembl Gene ENSMUSG00000070972
Gene NameDnaJ heat shock protein family (Hsp40) member C25
Synonyms2010203O07Rik, 2010109C08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6329 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location58995062-59025573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59013678 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 132 (Q132L)
Ref Sequence ENSEMBL: ENSMUSP00000123172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095070] [ENSMUST00000148366] [ENSMUST00000150309] [ENSMUST00000152199] [ENSMUST00000153467] [ENSMUST00000174664]
Predicted Effect probably benign
Transcript: ENSMUST00000095070
SMART Domains Protein: ENSMUSP00000092680
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 2.04e-19 SMART
low complexity region 125 138 N/A INTRINSIC
transmembrane domain 147 164 N/A INTRINSIC
coiled coil region 195 220 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148366
SMART Domains Protein: ENSMUSP00000116171
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150309
AA Change: Q132L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123172
Gene: ENSMUSG00000070972
AA Change: Q132L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 4.18e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152199
SMART Domains Protein: ENSMUSP00000118048
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 28 45 N/A INTRINSIC
coiled coil region 76 101 N/A INTRINSIC
transmembrane domain 122 144 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153467
AA Change: Q125L
SMART Domains Protein: ENSMUSP00000114320
Gene: ENSMUSG00000070972
AA Change: Q125L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 1.12e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174664
SMART Domains Protein: ENSMUSP00000134530
Gene: ENSMUSG00000092345

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 3.9e-16 SMART
G_gamma 94 150 1.06e-6 SMART
GGL 94 150 1.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,173,696 H72R probably damaging Het
Abca13 A T 11: 9,277,937 N660I probably damaging Het
Actr8 C T 14: 29,993,084 R619* probably null Het
Adam18 C A 8: 24,614,827 G657V probably damaging Het
Adcyap1 A G 17: 93,202,799 E85G probably benign Het
Akr1c14 A G 13: 4,087,302 Y305C probably damaging Het
Ankdd1b T A 13: 96,454,880 H37L possibly damaging Het
Ap4e1 T C 2: 127,061,716 L846P probably benign Het
Aqp9 A T 9: 71,132,684 Y105* probably null Het
Arid1b C T 17: 5,337,263 Q1664* probably null Het
Aup1 A G 6: 83,054,607 probably benign Het
Bnip1 C A 17: 26,786,710 S64* probably null Het
Calcr T A 6: 3,687,621 Q422L probably damaging Het
Ccdc162 T A 10: 41,663,151 D407V possibly damaging Het
Ccdc66 G T 14: 27,486,484 S760R probably benign Het
Cd22 T A 7: 30,877,768 E38V probably damaging Het
Cggbp1 T C 16: 64,856,020 Y150H probably damaging Het
Chd3 T C 11: 69,361,684 K263R possibly damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a2 T C 10: 76,599,828 T858A probably benign Het
Dnah7a T A 1: 53,541,114 D1554V probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Ehbp1l1 A C 19: 5,718,767 I836S possibly damaging Het
Elf1 A G 14: 79,573,339 Q288R possibly damaging Het
Fbn1 C A 2: 125,308,473 V2608L possibly damaging Het
Frmpd1 T C 4: 45,268,551 I232T possibly damaging Het
Fuca1 T A 4: 135,934,826 I355N probably damaging Het
Gcnt4 A G 13: 96,947,273 D359G probably damaging Het
Gm15448 T C 7: 3,822,851 T340A probably damaging Het
Gm5134 T C 10: 75,954,660 M30T possibly damaging Het
Grk1 T G 8: 13,405,704 L196R probably damaging Het
Igkv14-126 A C 6: 67,896,564 D92A probably damaging Het
Kmt2c A G 5: 25,315,602 S1837P probably benign Het
Lhx4 T A 1: 155,702,554 T281S probably benign Het
Lrrc55 G T 2: 85,196,309 H124N probably benign Het
March8 T A 6: 116,406,316 I566N possibly damaging Het
Mycbp2 G A 14: 103,155,852 A3091V probably benign Het
Nlrp4b A G 7: 10,724,920 N355S probably benign Het
Nmur2 A G 11: 56,029,585 V278A probably benign Het
Nod1 T C 6: 54,944,704 M210V probably benign Het
Nt5c1b T A 12: 10,372,138 C63* probably null Het
Olfr1164 G A 2: 88,093,664 P91S probably damaging Het
Olfr1288 C T 2: 111,479,228 A148V possibly damaging Het
Olfr346 A T 2: 36,688,682 K227* probably null Het
Olfr397 A G 11: 73,964,742 I45V possibly damaging Het
Olfr836 A C 9: 19,120,957 M1L probably benign Het
Olfr884 T C 9: 38,047,825 V201A probably benign Het
Olfr938 C T 9: 39,077,903 V281I probably benign Het
Osbp2 T A 11: 3,715,153 S517C probably damaging Het
Pcdha1 C T 18: 36,932,248 P655L probably damaging Het
Pdcd6 A G 13: 74,303,979 Y181H probably damaging Het
Perp G A 10: 18,855,754 G154S probably damaging Het
Perp G T 10: 18,855,755 G154V probably damaging Het
Prokr1 T G 6: 87,581,792 T204P possibly damaging Het
Prpf3 A T 3: 95,832,578 C630S probably damaging Het
Pter C A 2: 12,980,548 H230N probably damaging Het
Ptprs A T 17: 56,417,427 Y1167* probably null Het
Rad54l2 T C 9: 106,717,922 I279V possibly damaging Het
Rora T A 9: 69,373,186 L347Q probably damaging Het
Runx1t1 T G 4: 13,785,136 M1R probably null Het
Sdcbp A G 4: 6,381,064 S70G probably benign Het
Serpinb12 A G 1: 106,953,763 Y210C probably damaging Het
Sipa1 T C 19: 5,651,489 E1015G probably damaging Het
Slc15a2 A C 16: 36,751,782 L740R possibly damaging Het
Specc1 A G 11: 62,156,553 E916G probably damaging Het
Spta1 T C 1: 174,214,177 I1371T possibly damaging Het
Tagln3 T C 16: 45,713,002 M130V probably benign Het
Tchh A T 3: 93,446,445 E1064V unknown Het
Tdp1 A T 12: 99,914,071 S464C probably damaging Het
Tdp1 G C 12: 99,914,072 S464T probably benign Het
Tenm3 T C 8: 48,276,849 Y1374C probably damaging Het
Tmprss3 A T 17: 31,183,859 Y455* probably null Het
Ttc5 A G 14: 50,765,928 V433A possibly damaging Het
Wnt5a A T 14: 28,518,492 R180* probably null Het
Zfp53 A G 17: 21,508,110 D135G probably benign Het
Zfp619 T A 7: 39,537,545 C1000S probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Dnajc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02102:Dnajc25 APN 4 59017693 nonsense probably null
R0505:Dnajc25 UTSW 4 59020438 missense possibly damaging 0.87
R1195:Dnajc25 UTSW 4 59003415 missense probably damaging 1.00
R2437:Dnajc25 UTSW 4 59020234 missense probably damaging 1.00
R5689:Dnajc25 UTSW 4 59017716 missense probably damaging 0.99
R6023:Dnajc25 UTSW 4 59013752 missense possibly damaging 0.53
R7316:Dnajc25 UTSW 4 59017693 nonsense probably null
R7398:Dnajc25 UTSW 4 59017824 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGATGTAATGACCTGGAAA -3'
(R):5'- AGGTGTTTTAAGGTCTCCTCCT -3'

Sequencing Primer
(F):5'- CTCATTTTAAGCCGAGGACGTCATG -3'
(R):5'- CGCTAATGTGGCTAAAACATGTCG -3'
Posted On2018-04-02