Incidental Mutation 'R6310:Acly'
List |< first << previous [record 48 of 1871] next >> last >|
ID509553
Institutional Source Beutler Lab
Gene Symbol Acly
Ensembl Gene ENSMUSG00000020917
Gene NameATP citrate lyase
SynonymsA730098H14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001199296.1, NM_134037.3; MGI: 103251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6310 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100476353-100528000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 100482220 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 856 (G856A)
Ref Sequence ENSEMBL: ENSMUSP00000103012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007131] [ENSMUST00000107389] [ENSMUST00000165111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007131
AA Change: G846A

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007131
Gene: ENSMUSG00000020917
AA Change: G846A

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107389
AA Change: G856A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103012
Gene: ENSMUSG00000020917
AA Change: G856A

DomainStartEndE-ValueType
Pfam:Citrate_bind 244 421 1.7e-94 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 494 600 6.6e-15 PFAM
Pfam:Ligase_CoA 660 785 2.1e-16 PFAM
Pfam:Citrate_synt 879 1085 2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154151
Predicted Effect possibly damaging
Transcript: ENSMUST00000165111
AA Change: G846A

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127632
Gene: ENSMUSG00000020917
AA Change: G846A

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195956
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype Strain: 5287022; 3036686
Lethality: E7-E8
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mutation of this gene results in embryonic lethality. Heterozygous mutants display no obvious abnormalities. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI

All alleles(37) : Targeted(1) Gene trapped(35) Transgenic(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T A 1: 25,111,718 M1145L probably benign Het
Akap13 A T 7: 75,749,193 H2673L probably damaging Het
Bmpr1b A G 3: 141,864,536 S131P probably damaging Het
Cep72 A C 13: 74,053,025 S175A possibly damaging Het
Chd2 C T 7: 73,453,164 E1358K probably damaging Het
Cmip T C 8: 117,429,810 I308T possibly damaging Het
Cps1 A T 1: 67,142,981 N118I probably benign Het
Cux1 C T 5: 136,275,164 G1265D probably benign Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dhx58 T C 11: 100,699,367 S364G probably benign Het
Dis3l A C 9: 64,322,575 V274G probably benign Het
Fryl A T 5: 73,191,761 probably benign Het
Gbf1 A G 19: 46,280,005 H1272R probably damaging Het
Gjb3 A G 4: 127,326,640 V33A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm9964 T C 11: 79,296,650 probably benign Het
Grk5 T C 19: 61,080,911 I342T probably damaging Het
Hnf1b T A 11: 83,904,911 C527S probably damaging Het
Hoxd4 G T 2: 74,728,390 A186S possibly damaging Het
Ighv1-78 G A 12: 115,868,964 H54Y probably benign Het
Intu T A 3: 40,701,291 L936* probably null Het
Kcp G A 6: 29,493,258 R89W probably damaging Het
Kctd3 T C 1: 188,972,238 T779A probably benign Het
Muc16 G A 9: 18,641,950 P4349L probably benign Het
Nedd9 T C 13: 41,318,452 T178A probably benign Het
Nuak2 G T 1: 132,329,961 A204S probably damaging Het
Olfr566 T A 7: 102,857,205 I26F probably benign Het
Olfr807 T C 10: 129,754,659 R264G probably benign Het
Pcdhac2 C A 18: 37,145,771 Y601* probably null Het
Pla2g4a T A 1: 149,842,226 D624V possibly damaging Het
Plxnb1 T C 9: 109,109,728 V1386A probably damaging Het
Plxnd1 T A 6: 115,976,736 L623F possibly damaging Het
Pms2 T A 5: 143,923,583 S71R probably benign Het
Prkg1 T C 19: 30,569,251 D683G probably damaging Het
Rasgrp3 T A 17: 75,494,209 Y45N probably damaging Het
Rfc4 T C 16: 23,114,709 I233M probably benign Het
Sema3a G A 5: 13,557,019 G274S probably damaging Het
Sesn1 T C 10: 41,896,078 L201P probably damaging Het
Setx G A 2: 29,176,935 V2363I possibly damaging Het
Sh3glb1 A G 3: 144,697,467 S81P probably damaging Het
Sik3 A G 9: 46,178,486 S218G probably damaging Het
Slc12a2 C G 18: 57,915,506 F781L probably damaging Het
Slc12a6 A T 2: 112,335,839 I188F probably damaging Het
Slc34a2 A G 5: 53,064,797 probably null Het
Slc35f4 A G 14: 49,322,457 C44R probably damaging Het
Sytl1 G A 4: 133,260,998 P16S probably benign Het
Taok3 C T 5: 117,255,938 T592M possibly damaging Het
Tgfb1i1 T C 7: 128,252,837 F303L probably damaging Het
Txk T C 5: 72,736,417 S7G probably benign Het
Utp4 T C 8: 106,918,621 V550A probably benign Het
Vmn1r229 G A 17: 20,814,714 D74N probably benign Het
Zfp638 A G 6: 83,867,230 D25G possibly damaging Het
Zfp646 T C 7: 127,883,907 V1752A probably benign Het
Other mutations in Acly
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Acly APN 11 100495910 missense probably benign 0.00
IGL01661:Acly APN 11 100514342 splice site probably benign
IGL02349:Acly APN 11 100519679 missense probably benign 0.01
IGL02792:Acly APN 11 100478410 missense probably damaging 0.97
IGL03026:Acly APN 11 100519690 missense possibly damaging 0.94
IGL03144:Acly APN 11 100515083 missense possibly damaging 0.84
IGL03230:Acly APN 11 100494059 missense probably damaging 0.99
IGL03266:Acly APN 11 100483752 missense probably damaging 1.00
lupine UTSW 11 100515905 missense probably damaging 1.00
P0014:Acly UTSW 11 100484604 missense probably benign 0.03
R0195:Acly UTSW 11 100512974 missense possibly damaging 0.56
R0319:Acly UTSW 11 100504982 missense probably damaging 1.00
R0598:Acly UTSW 11 100478390 missense probably damaging 1.00
R1115:Acly UTSW 11 100479255 missense probably damaging 0.99
R1201:Acly UTSW 11 100493935 missense probably damaging 1.00
R1498:Acly UTSW 11 100483801 missense probably benign 0.27
R1593:Acly UTSW 11 100481755 missense possibly damaging 0.74
R1804:Acly UTSW 11 100515905 missense probably damaging 1.00
R1817:Acly UTSW 11 100495891 missense probably benign 0.00
R1980:Acly UTSW 11 100495876 missense possibly damaging 0.87
R1997:Acly UTSW 11 100519151 missense probably damaging 1.00
R2125:Acly UTSW 11 100523496 missense probably benign 0.01
R3001:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3002:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3003:Acly UTSW 11 100504227 missense possibly damaging 0.91
R5194:Acly UTSW 11 100523546 missense probably benign
R5509:Acly UTSW 11 100514979 missense probably damaging 0.97
R5594:Acly UTSW 11 100522120 intron probably null
R6077:Acly UTSW 11 100519757 missense probably benign
X0028:Acly UTSW 11 100495933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCGTAGAGCATGTTACTAACC -3'
(R):5'- AGGCATTCCTGAGAGCACAC -3'

Sequencing Primer
(F):5'- TCCAGCCCATAAAAGGTTTCTG -3'
(R):5'- ACCTGCCTCATTCATGAC -3'
Posted On2018-04-02