Incidental Mutation 'R6305:Thrap3'
ID509581
Institutional Source Beutler Lab
Gene Symbol Thrap3
Ensembl Gene ENSMUSG00000043962
Gene Namethyroid hormone receptor associated protein 3
Synonyms9330151F09Rik, B230333E16Rik, Trap150
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R6305 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126164082-126202760 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 126180807 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080919] [ENSMUST00000106142] [ENSMUST00000123008] [ENSMUST00000136157] [ENSMUST00000163306] [ENSMUST00000169403]
Predicted Effect unknown
Transcript: ENSMUST00000080919
AA Change: S49P
SMART Domains Protein: ENSMUSP00000079722
Gene: ENSMUSG00000043962
AA Change: S49P

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
low complexity region 77 95 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 123 788 1.9e-207 PFAM
low complexity region 790 801 N/A INTRINSIC
low complexity region 835 854 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106142
AA Change: S49P
SMART Domains Protein: ENSMUSP00000101748
Gene: ENSMUSG00000043962
AA Change: S49P

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
low complexity region 77 95 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 123 709 8.7e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123008
SMART Domains Protein: ENSMUSP00000131956
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136157
AA Change: S49P
SMART Domains Protein: ENSMUSP00000120140
Gene: ENSMUSG00000043962
AA Change: S49P

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151728
Predicted Effect probably benign
Transcript: ENSMUST00000163306
SMART Domains Protein: ENSMUSP00000126399
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 49 136 1.2e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169403
AA Change: S49P
SMART Domains Protein: ENSMUSP00000125856
Gene: ENSMUSG00000043962
AA Change: S49P

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169855
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,980 S977P probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adcy6 T A 15: 98,598,645 I550L probably benign Het
Agbl3 G A 6: 34,782,210 D19N unknown Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgap39 T A 15: 76,737,702 D233V probably benign Het
Bcl9 G A 3: 97,205,938 P1067L possibly damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Casd1 C T 6: 4,641,892 T723I probably damaging Het
Cd209g T A 8: 4,136,809 I118N probably benign Het
Cdh24 A T 14: 54,632,356 D701E possibly damaging Het
Chd9 C T 8: 91,030,546 P1858S possibly damaging Het
Csnk1g3 T A 18: 53,932,312 Y322* probably null Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
D130043K22Rik T C 13: 24,885,685 F909S probably damaging Het
Dll4 T A 2: 119,330,657 S299T probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dsg4 T A 18: 20,449,790 Y162N probably damaging Het
Enpp1 T C 10: 24,641,882 Y882C probably damaging Het
Fam129a T C 1: 151,695,718 L248P probably damaging Het
Fbxw7 T A 3: 84,976,323 N520K probably damaging Het
Galc C T 12: 98,259,290 A14T possibly damaging Het
Gm11492 C T 11: 87,567,319 T173M probably benign Het
Grm7 G A 6: 111,358,665 R679Q probably damaging Het
Hnrnpdl T C 5: 100,038,658 probably benign Het
Il12a A T 3: 68,694,178 K77N possibly damaging Het
Il17rd C T 14: 27,095,942 S196L possibly damaging Het
Kcnv2 T C 19: 27,323,837 F363L probably benign Het
Lair1 A G 7: 4,010,728 probably null Het
Lrit3 G A 3: 129,800,460 T156I probably damaging Het
Me2 T A 18: 73,791,844 R267S probably benign Het
Mga T C 2: 119,947,698 V1908A probably benign Het
Mylk3 T A 8: 85,350,419 I463F probably damaging Het
Neb G A 2: 52,251,763 R75* probably null Het
Olfr1080 A G 2: 86,553,495 S210P possibly damaging Het
Olfr339 T A 2: 36,421,622 S75T probably damaging Het
Olfr469 T G 7: 107,822,657 T271P probably benign Het
Olfr516 C T 7: 108,845,554 G152D possibly damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr883 TG TGGTGTTGG 9: 38,026,542 probably null Het
Pfas A G 11: 69,001,197 S162P possibly damaging Het
Pip5k1c T A 10: 81,315,934 V654E probably benign Het
Plxdc1 C A 11: 97,938,590 C318F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rexo5 A T 7: 119,828,125 K419N probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc24a4 C A 12: 102,222,101 T151K possibly damaging Het
Slc6a15 A T 10: 103,389,170 I40F probably benign Het
Slc6a21 T C 7: 45,280,604 V172A possibly damaging Het
Tm9sf3 A G 19: 41,245,442 probably null Het
Trp53 A T 11: 69,588,707 H211L probably damaging Het
Ttc21b A T 2: 66,188,270 N1264K probably damaging Het
Vmn1r120 A T 7: 21,053,606 V60E possibly damaging Het
Ylpm1 A G 12: 85,030,545 E890G probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp934 T C 13: 62,518,556 Y102C probably damaging Het
Other mutations in Thrap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00654:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00763:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00907:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00990:Thrap3 APN 4 126165395 unclassified probably benign
IGL01722:Thrap3 APN 4 126165529 missense possibly damaging 0.87
IGL02487:Thrap3 APN 4 126167001 missense possibly damaging 0.93
IGL02802:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02837:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02988:Thrap3 UTSW 4 126165542 splice site probably null
IGL03050:Thrap3 UTSW 4 126165542 splice site probably null
IGL03055:Thrap3 UTSW 4 126165542 splice site probably null
R0585:Thrap3 UTSW 4 126178574 unclassified probably null
R1023:Thrap3 UTSW 4 126180089 missense possibly damaging 0.73
R1237:Thrap3 UTSW 4 126180069 missense probably benign 0.02
R1445:Thrap3 UTSW 4 126176336 missense probably damaging 1.00
R1601:Thrap3 UTSW 4 126180101 missense probably damaging 1.00
R2058:Thrap3 UTSW 4 126180174 missense probably damaging 1.00
R2063:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2064:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2065:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2066:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2067:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2098:Thrap3 UTSW 4 126180030 missense probably damaging 1.00
R3791:Thrap3 UTSW 4 126167500 missense possibly damaging 0.76
R4052:Thrap3 UTSW 4 126176219 missense probably damaging 1.00
R4097:Thrap3 UTSW 4 126171802 missense probably damaging 1.00
R4153:Thrap3 UTSW 4 126173442 critical splice donor site probably null
R4399:Thrap3 UTSW 4 126167079 splice site probably benign
R5265:Thrap3 UTSW 4 126167640 missense probably damaging 1.00
R5687:Thrap3 UTSW 4 126180486 unclassified probably benign
R5993:Thrap3 UTSW 4 126175460 unclassified probably null
R6917:Thrap3 UTSW 4 126180492 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAATTGGAACGGTAGTTTCC -3'
(R):5'- TGCTAAGTGTCCTGTGCCTG -3'

Sequencing Primer
(F):5'- TGGAACGGTAGTTTCCATAGCCAC -3'
(R):5'- CAGTGTTAACTTTTGTTGGC -3'
Posted On2018-04-02