Incidental Mutation 'R6306:Cfh'
ID509634
Institutional Source Beutler Lab
Gene Symbol Cfh
Ensembl Gene ENSMUSG00000026365
Gene Namecomplement component factor h
SynonymsMud-1, Sas1, Sas-1
MMRRC Submission
Accession Numbers

Genbank: NM_009888; MGI: 88385

Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6306 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location140084708-140183764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140102417 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 906 (C906Y)
Ref Sequence ENSEMBL: ENSMUSP00000115166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066859] [ENSMUST00000111976] [ENSMUST00000111977] [ENSMUST00000123238] [ENSMUST00000192880]
Predicted Effect probably damaging
Transcript: ENSMUST00000066859
AA Change: C906Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066677
Gene: ENSMUSG00000026365
AA Change: C906Y

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
CCP 1114 1168 8.04e-15 SMART
CCP 1172 1233 5.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111976
AA Change: C924Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107607
Gene: ENSMUSG00000026365
AA Change: C924Y

DomainStartEndE-ValueType
CCP 39 98 7.75e-8 SMART
CCP 103 159 2.17e-11 SMART
CCP 164 223 7.5e-15 SMART
CCP 228 280 6.29e-8 SMART
CCP 285 338 2.04e-7 SMART
CCP 343 403 6.35e-4 SMART
CCP 407 460 1.15e-10 SMART
CCP 466 523 3.62e-8 SMART
CCP 527 582 6.45e-5 SMART
CCP 587 640 5.56e-9 SMART
CCP 647 701 3.45e-14 SMART
CCP 708 761 1.82e-13 SMART
CCP 770 820 6.59e-1 SMART
CCP 826 879 1.04e-8 SMART
CCP 885 949 4.66e-11 SMART
CCP 954 1007 3.9e-13 SMART
CCP 1012 1066 1.4e-14 SMART
CCP 1071 1125 2.09e-13 SMART
CCP 1132 1186 8.04e-15 SMART
CCP 1190 1251 5.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111977
AA Change: C867Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107608
Gene: ENSMUSG00000026365
AA Change: C867Y

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 572 626 3.45e-14 SMART
CCP 633 686 1.82e-13 SMART
CCP 695 745 6.59e-1 SMART
CCP 751 804 1.04e-8 SMART
CCP 810 874 4.66e-11 SMART
CCP 879 932 3.9e-13 SMART
CCP 937 991 1.4e-14 SMART
CCP 996 1050 2.09e-13 SMART
CCP 1057 1111 8.04e-15 SMART
CCP 1115 1176 5.57e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123238
AA Change: C906Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115166
Gene: ENSMUSG00000026365
AA Change: C906Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192880
SMART Domains Protein: ENSMUSP00000141209
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CCP 39 98 3.9e-10 SMART
CCP 103 159 1e-13 SMART
CCP 164 223 3.7e-17 SMART
CCP 228 280 3.1e-10 SMART
CCP 285 338 9.9e-10 SMART
CCP 343 403 3.2e-6 SMART
CCP 407 460 5.6e-13 SMART
CCP 467 521 6.7e-17 SMART
CCP 526 580 1e-15 SMART
CCP 587 641 3.8e-17 SMART
CCP 645 706 2.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192919
Meta Mutation Damage Score 0.506 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene results in markedly reduced serum C3, abnormal renal histology, spontaneous membranoproliferative glomerulonephritis (MPGN), hematuria, proteinuria, and increased mortality at 8 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,706,150 N495S possibly damaging Het
Adamts7 G A 9: 90,178,278 probably null Het
Adora2a T A 10: 75,333,404 V234E probably damaging Het
Alpk1 T C 3: 127,686,316 D188G probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ankrd17 A G 5: 90,244,154 F1886L probably benign Het
Anks1 T G 17: 28,050,639 L769R probably damaging Het
Apol10a A G 15: 77,488,961 I266V probably benign Het
Arhgef28 T C 13: 97,985,388 Y556C probably damaging Het
Brd8 T A 18: 34,611,251 T175S probably damaging Het
Camsap2 C T 1: 136,281,199 V852I probably benign Het
Cd55b G T 1: 130,414,066 P278Q probably damaging Het
Cep290 T A 10: 100,531,166 S1126R possibly damaging Het
Chst13 C A 6: 90,309,278 R234L probably damaging Het
Clcn7 T C 17: 25,157,528 F611L probably benign Het
Cntnap1 A G 11: 101,184,615 D873G probably damaging Het
Cntnap5b T C 1: 100,164,146 I518T probably damaging Het
Col28a1 T C 6: 8,014,969 E812G probably damaging Het
Cpa1 T C 6: 30,640,954 I148T probably damaging Het
Cyp11a1 A G 9: 58,025,100 N232S probably benign Het
Dhrs13 A G 11: 78,032,693 D79G probably damaging Het
Disp1 T C 1: 183,087,148 E1236G possibly damaging Het
Dnah1 A C 14: 31,304,587 L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,585,024 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock9 A T 14: 121,562,080 I1729N probably damaging Het
Dysf T C 6: 84,137,266 V1192A possibly damaging Het
Enpp2 A G 15: 54,899,346 S169P probably damaging Het
Fam114a2 T G 11: 57,514,146 R43S probably damaging Het
Fam13a T C 6: 58,940,254 T546A probably benign Het
Fos A T 12: 85,475,686 D163V probably damaging Het
Fras1 T C 5: 96,764,946 Y3370H probably damaging Het
Fshr T C 17: 89,200,533 N27S probably null Het
Galnt6 A G 15: 100,693,424 S600P possibly damaging Het
Gars T A 6: 55,055,824 N260K probably damaging Het
Gpr158 C G 2: 21,815,611 P640A possibly damaging Het
Grik3 A G 4: 125,632,412 D146G probably benign Het
Hdac4 T C 1: 91,996,174 T205A probably benign Het
Kcnq3 T C 15: 66,004,794 D500G probably benign Het
Kmt5c A G 7: 4,746,481 K333E probably benign Het
Krt81 A G 15: 101,459,523 S443P probably benign Het
M6pr T C 6: 122,315,162 probably null Het
Mccc2 T A 13: 99,993,577 I91L probably benign Het
Nip7 A G 8: 107,058,423 D110G probably damaging Het
Nol8 T A 13: 49,676,353 F1093I probably damaging Het
Nrxn1 T C 17: 90,565,446 T1027A possibly damaging Het
Ofcc1 T A 13: 40,148,576 M495L probably benign Het
Olfr18 A G 9: 20,314,446 M158T probably benign Het
Olfr62 A T 4: 118,666,293 M259L probably benign Het
Pafah1b2 A T 9: 45,975,127 V81D probably damaging Het
Pcdhga4 A T 18: 37,685,913 S172C probably damaging Het
Pds5a A G 5: 65,656,296 V282A probably damaging Het
Plat A G 8: 22,772,266 D102G possibly damaging Het
Plce1 C A 19: 38,769,465 Q1961K probably damaging Het
Plppr3 T A 10: 79,861,732 K444* probably null Het
Plscr3 A G 11: 69,847,646 probably null Het
Prtg A T 9: 72,906,186 T943S probably benign Het
Racgap1 A G 15: 99,623,953 F519L probably benign Het
Rbms2 A T 10: 128,151,181 probably null Het
Rfx7 A G 9: 72,616,955 T476A possibly damaging Het
Rnf150 T A 8: 83,083,502 L421Q possibly damaging Het
Sema3b A G 9: 107,600,920 L422P possibly damaging Het
Shank2 G A 7: 144,409,680 A921T probably benign Het
Skint3 A T 4: 112,255,875 E227D probably damaging Het
Slc25a19 G A 11: 115,617,560 R201C possibly damaging Het
Slc38a10 G T 11: 120,147,819 A40D probably damaging Het
Slc5a4b T C 10: 76,081,351 T284A probably benign Het
Smc1b A T 15: 85,127,623 F154I probably benign Het
Spry2 A T 14: 105,892,984 M256K possibly damaging Het
Stkld1 C T 2: 26,943,887 P129S probably damaging Het
Syce2 T C 8: 84,872,742 L13S possibly damaging Het
Tbc1d15 C A 10: 115,233,243 V74L possibly damaging Het
Tecpr2 T A 12: 110,944,751 V1074D probably damaging Het
Tex36 G A 7: 133,595,325 T21I probably benign Het
Ttn T G 2: 76,724,110 D30787A probably damaging Het
Ttn T A 2: 76,791,920 Q13710L probably benign Het
Usp34 T C 11: 23,412,260 F1569L possibly damaging Het
Vat1l C T 8: 114,371,651 A387V probably damaging Het
Vil1 G A 1: 74,421,311 G209D possibly damaging Het
Vmn1r113 G T 7: 20,787,867 D195Y probably damaging Het
Vmn2r69 A C 7: 85,415,591 I29R probably benign Het
Vti1b G A 12: 79,160,549 Q76* probably null Het
Zfp423 C A 8: 87,782,034 V540F possibly damaging Het
Zfp644 T C 5: 106,638,124 N186D probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp787 G A 7: 6,132,361 A297V probably damaging Het
Zfp827 G T 8: 79,060,695 Q163H probably damaging Het
Zfp955b T A 17: 33,303,186 V543E probably benign Het
Other mutations in Cfh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cfh APN 1 140088682 missense probably damaging 1.00
IGL01124:Cfh APN 1 140183261 missense probably benign 0.01
IGL01389:Cfh APN 1 140154639 missense probably benign 0.44
IGL01455:Cfh APN 1 140105539 missense possibly damaging 0.51
IGL01877:Cfh APN 1 140100829 missense probably damaging 1.00
IGL02836:Cfh APN 1 140102399 missense probably damaging 1.00
IGL02937:Cfh APN 1 140105442 missense probably benign 0.19
IGL03039:Cfh APN 1 140136261 missense possibly damaging 0.86
IGL03069:Cfh APN 1 140099055 intron probably benign
IGL03192:Cfh APN 1 140099021 missense possibly damaging 0.71
IGL03201:Cfh APN 1 140102819 missense probably damaging 1.00
3-1:Cfh UTSW 1 140163125 missense probably damaging 1.00
PIT4449001:Cfh UTSW 1 140112565 missense probably damaging 1.00
R0257:Cfh UTSW 1 140144035 missense probably benign 0.01
R0294:Cfh UTSW 1 140183261 missense probably benign 0.01
R0571:Cfh UTSW 1 140102333 splice site probably null
R0576:Cfh UTSW 1 140136815 missense probably damaging 0.99
R0586:Cfh UTSW 1 140183182 missense probably damaging 0.98
R0605:Cfh UTSW 1 140102358 missense probably damaging 1.00
R0617:Cfh UTSW 1 140100883 missense probably benign 0.01
R0725:Cfh UTSW 1 140157343 splice site probably benign
R0853:Cfh UTSW 1 140105490 missense probably damaging 1.00
R1430:Cfh UTSW 1 140102698 splice site probably benign
R1500:Cfh UTSW 1 140100876 missense probably damaging 1.00
R1533:Cfh UTSW 1 140100978 missense possibly damaging 0.86
R1667:Cfh UTSW 1 140105523 missense probably benign 0.01
R1695:Cfh UTSW 1 140102837 missense probably damaging 0.98
R1728:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1729:Cfh UTSW 1 140136788 missense probably benign 0.02
R1729:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1730:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1739:Cfh UTSW 1 140136788 missense probably benign 0.02
R1739:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1756:Cfh UTSW 1 140100877 missense probably damaging 1.00
R1762:Cfh UTSW 1 140136788 missense probably benign 0.02
R1762:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1783:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1784:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1785:Cfh UTSW 1 140136788 missense probably benign 0.02
R1785:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1912:Cfh UTSW 1 140136141 splice site probably null
R2273:Cfh UTSW 1 140102825 missense probably damaging 1.00
R2288:Cfh UTSW 1 140098901 missense possibly damaging 0.70
R3725:Cfh UTSW 1 140086496 missense probably damaging 0.99
R3731:Cfh UTSW 1 140119970 missense possibly damaging 0.71
R4060:Cfh UTSW 1 140119926 missense possibly damaging 0.91
R4192:Cfh UTSW 1 140102716 missense possibly damaging 0.50
R4226:Cfh UTSW 1 140108926 missense probably damaging 1.00
R4425:Cfh UTSW 1 140100875 nonsense probably null
R4431:Cfh UTSW 1 140136266 missense probably damaging 1.00
R4712:Cfh UTSW 1 140108536 missense probably damaging 1.00
R4755:Cfh UTSW 1 140088808 missense probably damaging 1.00
R4792:Cfh UTSW 1 140100823 nonsense probably null
R4831:Cfh UTSW 1 140086387 missense probably benign
R5052:Cfh UTSW 1 140144044 missense probably damaging 0.96
R5181:Cfh UTSW 1 140147646 splice site probably benign
R5205:Cfh UTSW 1 140143970 missense probably damaging 1.00
R5285:Cfh UTSW 1 140100898 missense probably benign 0.21
R5366:Cfh UTSW 1 140136235 missense probably damaging 1.00
R5776:Cfh UTSW 1 140144023 missense possibly damaging 0.83
R5914:Cfh UTSW 1 140136229 missense probably benign 0.39
R5948:Cfh UTSW 1 140108808 missense probably damaging 0.96
R5979:Cfh UTSW 1 140118671 missense possibly damaging 0.66
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6059:Cfh UTSW 1 140118690 missense possibly damaging 0.92
R6198:Cfh UTSW 1 140105440 missense probably damaging 1.00
R6523:Cfh UTSW 1 140101707 missense possibly damaging 0.82
R6610:Cfh UTSW 1 140101748 nonsense probably null
R6652:Cfh UTSW 1 140144068 missense probably benign 0.39
R6852:Cfh UTSW 1 140147749 missense probably damaging 1.00
R6861:Cfh UTSW 1 140100883 missense probably benign 0.07
R6862:Cfh UTSW 1 140102362 missense probably damaging 1.00
R7065:Cfh UTSW 1 140086402 missense probably damaging 0.99
R7191:Cfh UTSW 1 140112567 missense probably benign 0.04
R7197:Cfh UTSW 1 140088767 nonsense probably null
R7355:Cfh UTSW 1 140136815 missense probably damaging 1.00
R7367:Cfh UTSW 1 140086521 missense probably damaging 0.97
R7419:Cfh UTSW 1 140105466 missense probably damaging 0.99
T0975:Cfh UTSW 1 140154598 missense probably benign 0.05
Z1088:Cfh UTSW 1 140108904 missense probably benign 0.04
Z1088:Cfh UTSW 1 140147718 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTGGACTTTAACACTTGGTGGC -3'
(R):5'- TCAGGTGACGGGATAGGTACTG -3'

Sequencing Primer
(F):5'- GGACTTTAACACTTGGTGGCAAATC -3'
(R):5'- CTGGACACATAATTCAAACAGTGTG -3'
Posted On2018-04-02