Incidental Mutation 'R6306:Gpr158'
ID509637
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene NameG protein-coupled receptor 158
Synonyms5330427M13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6306 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location21367542-21830547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 21815611 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 640 (P640A)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055946
AA Change: P640A

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: P640A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155760
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,706,150 N495S possibly damaging Het
Adamts7 G A 9: 90,178,278 probably null Het
Adora2a T A 10: 75,333,404 V234E probably damaging Het
Alpk1 T C 3: 127,686,316 D188G probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ankrd17 A G 5: 90,244,154 F1886L probably benign Het
Anks1 T G 17: 28,050,639 L769R probably damaging Het
Apol10a A G 15: 77,488,961 I266V probably benign Het
Arhgef28 T C 13: 97,985,388 Y556C probably damaging Het
Brd8 T A 18: 34,611,251 T175S probably damaging Het
Camsap2 C T 1: 136,281,199 V852I probably benign Het
Cd55b G T 1: 130,414,066 P278Q probably damaging Het
Cep290 T A 10: 100,531,166 S1126R possibly damaging Het
Cfh C T 1: 140,102,417 C906Y probably damaging Het
Chst13 C A 6: 90,309,278 R234L probably damaging Het
Clcn7 T C 17: 25,157,528 F611L probably benign Het
Cntnap1 A G 11: 101,184,615 D873G probably damaging Het
Cntnap5b T C 1: 100,164,146 I518T probably damaging Het
Col28a1 T C 6: 8,014,969 E812G probably damaging Het
Cpa1 T C 6: 30,640,954 I148T probably damaging Het
Cyp11a1 A G 9: 58,025,100 N232S probably benign Het
Dhrs13 A G 11: 78,032,693 D79G probably damaging Het
Disp1 T C 1: 183,087,148 E1236G possibly damaging Het
Dnah1 A C 14: 31,304,587 L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,585,024 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock9 A T 14: 121,562,080 I1729N probably damaging Het
Dysf T C 6: 84,137,266 V1192A possibly damaging Het
Enpp2 A G 15: 54,899,346 S169P probably damaging Het
Fam114a2 T G 11: 57,514,146 R43S probably damaging Het
Fam13a T C 6: 58,940,254 T546A probably benign Het
Fos A T 12: 85,475,686 D163V probably damaging Het
Fras1 T C 5: 96,764,946 Y3370H probably damaging Het
Fshr T C 17: 89,200,533 N27S probably null Het
Galnt6 A G 15: 100,693,424 S600P possibly damaging Het
Gars T A 6: 55,055,824 N260K probably damaging Het
Grik3 A G 4: 125,632,412 D146G probably benign Het
Hdac4 T C 1: 91,996,174 T205A probably benign Het
Kcnq3 T C 15: 66,004,794 D500G probably benign Het
Kmt5c A G 7: 4,746,481 K333E probably benign Het
Krt81 A G 15: 101,459,523 S443P probably benign Het
M6pr T C 6: 122,315,162 probably null Het
Mccc2 T A 13: 99,993,577 I91L probably benign Het
Nip7 A G 8: 107,058,423 D110G probably damaging Het
Nol8 T A 13: 49,676,353 F1093I probably damaging Het
Nrxn1 T C 17: 90,565,446 T1027A possibly damaging Het
Ofcc1 T A 13: 40,148,576 M495L probably benign Het
Olfr18 A G 9: 20,314,446 M158T probably benign Het
Olfr62 A T 4: 118,666,293 M259L probably benign Het
Pafah1b2 A T 9: 45,975,127 V81D probably damaging Het
Pcdhga4 A T 18: 37,685,913 S172C probably damaging Het
Pds5a A G 5: 65,656,296 V282A probably damaging Het
Plat A G 8: 22,772,266 D102G possibly damaging Het
Plce1 C A 19: 38,769,465 Q1961K probably damaging Het
Plppr3 T A 10: 79,861,732 K444* probably null Het
Plscr3 A G 11: 69,847,646 probably null Het
Prtg A T 9: 72,906,186 T943S probably benign Het
Racgap1 A G 15: 99,623,953 F519L probably benign Het
Rbms2 A T 10: 128,151,181 probably null Het
Rfx7 A G 9: 72,616,955 T476A possibly damaging Het
Rnf150 T A 8: 83,083,502 L421Q possibly damaging Het
Sema3b A G 9: 107,600,920 L422P possibly damaging Het
Shank2 G A 7: 144,409,680 A921T probably benign Het
Skint3 A T 4: 112,255,875 E227D probably damaging Het
Slc25a19 G A 11: 115,617,560 R201C possibly damaging Het
Slc38a10 G T 11: 120,147,819 A40D probably damaging Het
Slc5a4b T C 10: 76,081,351 T284A probably benign Het
Smc1b A T 15: 85,127,623 F154I probably benign Het
Spry2 A T 14: 105,892,984 M256K possibly damaging Het
Stkld1 C T 2: 26,943,887 P129S probably damaging Het
Syce2 T C 8: 84,872,742 L13S possibly damaging Het
Tbc1d15 C A 10: 115,233,243 V74L possibly damaging Het
Tecpr2 T A 12: 110,944,751 V1074D probably damaging Het
Tex36 G A 7: 133,595,325 T21I probably benign Het
Ttn T A 2: 76,791,920 Q13710L probably benign Het
Ttn T G 2: 76,724,110 D30787A probably damaging Het
Usp34 T C 11: 23,412,260 F1569L possibly damaging Het
Vat1l C T 8: 114,371,651 A387V probably damaging Het
Vil1 G A 1: 74,421,311 G209D possibly damaging Het
Vmn1r113 G T 7: 20,787,867 D195Y probably damaging Het
Vmn2r69 A C 7: 85,415,591 I29R probably benign Het
Vti1b G A 12: 79,160,549 Q76* probably null Het
Zfp423 C A 8: 87,782,034 V540F possibly damaging Het
Zfp644 T C 5: 106,638,124 N186D probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp787 G A 7: 6,132,361 A297V probably damaging Het
Zfp827 G T 8: 79,060,695 Q163H probably damaging Het
Zfp955b T A 17: 33,303,186 V543E probably benign Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
PIT4810001:Gpr158 UTSW 2 21826871 missense probably benign 0.01
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4379:Gpr158 UTSW 2 21825214 missense probably damaging 1.00
R4381:Gpr158 UTSW 2 21827592 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4882:Gpr158 UTSW 2 21825248 missense probably damaging 0.98
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5701:Gpr158 UTSW 2 21746709 missense probably damaging 1.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
R6997:Gpr158 UTSW 2 21648991 missense possibly damaging 0.46
R7086:Gpr158 UTSW 2 21826575 missense probably benign 0.01
R7175:Gpr158 UTSW 2 21368302 missense probably benign 0.13
R7197:Gpr158 UTSW 2 21810601 missense probably damaging 0.99
R7293:Gpr158 UTSW 2 21576939 missense possibly damaging 0.47
R7427:Gpr158 UTSW 2 21827318 missense probably benign
R7515:Gpr158 UTSW 2 21368281 missense not run
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGTCCTTCCAACCTAAAAGTC -3'
(R):5'- ACACTCGCTTTCTTGAGGAGG -3'

Sequencing Primer
(F):5'- GTCCTTCCAACCTAAAAGTCATTTAC -3'
(R):5'- CAAATAATGGTGGAGCATCAAGC -3'
Posted On2018-04-02