Incidental Mutation 'R6306:Plat'
ID509662
Institutional Source Beutler Lab
Gene Symbol Plat
Ensembl Gene ENSMUSG00000031538
Gene Nameplasminogen activator, tissue
Synonymst-PA, D8Ertd2e, tPA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6306 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22757727-22782844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22772266 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 102 (D102G)
Ref Sequence ENSEMBL: ENSMUSP00000033941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033941
AA Change: D102G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033941
Gene: ENSMUSG00000031538
AA Change: D102G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FN1 38 80 5.69e-15 SMART
EGF 82 117 4.92e-5 SMART
KR 122 207 3.77e-33 SMART
KR 211 296 4.39e-34 SMART
Tryp_SPc 308 553 6.59e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210960
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: This gene encodes a key enzyme of the fibrinolytic pathway. The encoded protein undergoes proteolytic processing by plasmin to generate a heterodimeric serine protease that cleaves the proenzyme plasminogen to produce plasmin, a protease that is required to break down fibrin clots. Additionally, the encoded protein is involved in other biological processes such as synaptic plasticity, cell migration and tissue remodeling. Mice lacking the encoded protein display a reduction in long-term potentiation in hippocampus and conversely, transgenic mice overexpressing the encoded protein have increased and prolonged long-term potentiation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal behavior, CNS synpatic transmission, and response to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,706,150 N495S possibly damaging Het
Adamts7 G A 9: 90,178,278 probably null Het
Adora2a T A 10: 75,333,404 V234E probably damaging Het
Alpk1 T C 3: 127,686,316 D188G probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ankrd17 A G 5: 90,244,154 F1886L probably benign Het
Anks1 T G 17: 28,050,639 L769R probably damaging Het
Apol10a A G 15: 77,488,961 I266V probably benign Het
Arhgef28 T C 13: 97,985,388 Y556C probably damaging Het
Brd8 T A 18: 34,611,251 T175S probably damaging Het
Camsap2 C T 1: 136,281,199 V852I probably benign Het
Cd55b G T 1: 130,414,066 P278Q probably damaging Het
Cep290 T A 10: 100,531,166 S1126R possibly damaging Het
Cfh C T 1: 140,102,417 C906Y probably damaging Het
Chst13 C A 6: 90,309,278 R234L probably damaging Het
Clcn7 T C 17: 25,157,528 F611L probably benign Het
Cntnap1 A G 11: 101,184,615 D873G probably damaging Het
Cntnap5b T C 1: 100,164,146 I518T probably damaging Het
Col28a1 T C 6: 8,014,969 E812G probably damaging Het
Cpa1 T C 6: 30,640,954 I148T probably damaging Het
Cyp11a1 A G 9: 58,025,100 N232S probably benign Het
Dhrs13 A G 11: 78,032,693 D79G probably damaging Het
Disp1 T C 1: 183,087,148 E1236G possibly damaging Het
Dnah1 A C 14: 31,304,587 L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,585,024 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock9 A T 14: 121,562,080 I1729N probably damaging Het
Dysf T C 6: 84,137,266 V1192A possibly damaging Het
Enpp2 A G 15: 54,899,346 S169P probably damaging Het
Fam114a2 T G 11: 57,514,146 R43S probably damaging Het
Fam13a T C 6: 58,940,254 T546A probably benign Het
Fos A T 12: 85,475,686 D163V probably damaging Het
Fras1 T C 5: 96,764,946 Y3370H probably damaging Het
Fshr T C 17: 89,200,533 N27S probably null Het
Galnt6 A G 15: 100,693,424 S600P possibly damaging Het
Gars T A 6: 55,055,824 N260K probably damaging Het
Gpr158 C G 2: 21,815,611 P640A possibly damaging Het
Grik3 A G 4: 125,632,412 D146G probably benign Het
Hdac4 T C 1: 91,996,174 T205A probably benign Het
Kcnq3 T C 15: 66,004,794 D500G probably benign Het
Kmt5c A G 7: 4,746,481 K333E probably benign Het
Krt81 A G 15: 101,459,523 S443P probably benign Het
M6pr T C 6: 122,315,162 probably null Het
Mccc2 T A 13: 99,993,577 I91L probably benign Het
Nip7 A G 8: 107,058,423 D110G probably damaging Het
Nol8 T A 13: 49,676,353 F1093I probably damaging Het
Nrxn1 T C 17: 90,565,446 T1027A possibly damaging Het
Ofcc1 T A 13: 40,148,576 M495L probably benign Het
Olfr18 A G 9: 20,314,446 M158T probably benign Het
Olfr62 A T 4: 118,666,293 M259L probably benign Het
Pafah1b2 A T 9: 45,975,127 V81D probably damaging Het
Pcdhga4 A T 18: 37,685,913 S172C probably damaging Het
Pds5a A G 5: 65,656,296 V282A probably damaging Het
Plce1 C A 19: 38,769,465 Q1961K probably damaging Het
Plppr3 T A 10: 79,861,732 K444* probably null Het
Plscr3 A G 11: 69,847,646 probably null Het
Prtg A T 9: 72,906,186 T943S probably benign Het
Racgap1 A G 15: 99,623,953 F519L probably benign Het
Rbms2 A T 10: 128,151,181 probably null Het
Rfx7 A G 9: 72,616,955 T476A possibly damaging Het
Rnf150 T A 8: 83,083,502 L421Q possibly damaging Het
Sema3b A G 9: 107,600,920 L422P possibly damaging Het
Shank2 G A 7: 144,409,680 A921T probably benign Het
Skint3 A T 4: 112,255,875 E227D probably damaging Het
Slc25a19 G A 11: 115,617,560 R201C possibly damaging Het
Slc38a10 G T 11: 120,147,819 A40D probably damaging Het
Slc5a4b T C 10: 76,081,351 T284A probably benign Het
Smc1b A T 15: 85,127,623 F154I probably benign Het
Spry2 A T 14: 105,892,984 M256K possibly damaging Het
Stkld1 C T 2: 26,943,887 P129S probably damaging Het
Syce2 T C 8: 84,872,742 L13S possibly damaging Het
Tbc1d15 C A 10: 115,233,243 V74L possibly damaging Het
Tecpr2 T A 12: 110,944,751 V1074D probably damaging Het
Tex36 G A 7: 133,595,325 T21I probably benign Het
Ttn T G 2: 76,724,110 D30787A probably damaging Het
Ttn T A 2: 76,791,920 Q13710L probably benign Het
Usp34 T C 11: 23,412,260 F1569L possibly damaging Het
Vat1l C T 8: 114,371,651 A387V probably damaging Het
Vil1 G A 1: 74,421,311 G209D possibly damaging Het
Vmn1r113 G T 7: 20,787,867 D195Y probably damaging Het
Vmn2r69 A C 7: 85,415,591 I29R probably benign Het
Vti1b G A 12: 79,160,549 Q76* probably null Het
Zfp423 C A 8: 87,782,034 V540F possibly damaging Het
Zfp644 T C 5: 106,638,124 N186D probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp787 G A 7: 6,132,361 A297V probably damaging Het
Zfp827 G T 8: 79,060,695 Q163H probably damaging Het
Zfp955b T A 17: 33,303,186 V543E probably benign Het
Other mutations in Plat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Plat APN 8 22776828 missense probably benign 0.00
IGL01918:Plat APN 8 22780437 missense possibly damaging 0.82
IGL01998:Plat APN 8 22767147 missense probably benign 0.31
IGL02978:Plat APN 8 22776819 missense probably damaging 1.00
R0829:Plat UTSW 8 22772257 missense probably damaging 1.00
R1065:Plat UTSW 8 22776863 missense probably damaging 0.99
R2316:Plat UTSW 8 22776865 missense probably benign 0.04
R4485:Plat UTSW 8 22772212 missense probably benign 0.01
R4873:Plat UTSW 8 22768450 missense probably benign 0.03
R4875:Plat UTSW 8 22768450 missense probably benign 0.03
R4924:Plat UTSW 8 22778253 missense probably damaging 1.00
R5051:Plat UTSW 8 22773672 missense probably benign 0.01
R5062:Plat UTSW 8 22772311 missense probably benign 0.19
R5402:Plat UTSW 8 22772722 missense probably damaging 1.00
R5672:Plat UTSW 8 22773648 missense probably benign 0.40
R7035:Plat UTSW 8 22772311 missense probably benign 0.32
R7154:Plat UTSW 8 22778505 missense possibly damaging 0.76
R7297:Plat UTSW 8 22775697 missense probably benign 0.12
R7432:Plat UTSW 8 22773651 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACTTTCCATGCTTCGCGG -3'
(R):5'- AGTCTCTAAATGACCTCAGCTCC -3'

Sequencing Primer
(F):5'- CATGCTTCGCGGTTGACAG -3'
(R):5'- AGCTCCCCTTCTGTGGG -3'
Posted On2018-04-02