Incidental Mutation 'R6306:Plppr3'
ID509679
Institutional Source Beutler Lab
Gene Symbol Plppr3
Ensembl Gene ENSMUSG00000035835
Gene Namephospholipid phosphatase related 3
SynonymsBC005764, Lppr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6306 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79860475-79874634 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 79861732 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 444 (K444*)
Ref Sequence ENSEMBL: ENSMUSP00000130695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057343] [ENSMUST00000092325] [ENSMUST00000095457] [ENSMUST00000165601] [ENSMUST00000165704] [ENSMUST00000165724] [ENSMUST00000167250] [ENSMUST00000167897] [ENSMUST00000168683] [ENSMUST00000169483] [ENSMUST00000171599] [ENSMUST00000172282]
Predicted Effect probably benign
Transcript: ENSMUST00000057343
SMART Domains Protein: ENSMUSP00000059481
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092325
SMART Domains Protein: ENSMUSP00000089979
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
coiled coil region 430 460 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095457
SMART Domains Protein: ENSMUSP00000093109
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_6 36 86 1.9e-5 PFAM
Pfam:RRM_5 38 90 3.6e-12 PFAM
low complexity region 121 138 N/A INTRINSIC
RRM 144 213 4.75e-7 SMART
low complexity region 265 290 N/A INTRINSIC
RRM 296 365 1.84e-13 SMART
RRM 413 483 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165153
Predicted Effect probably benign
Transcript: ENSMUST00000165601
SMART Domains Protein: ENSMUSP00000128681
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 266 7.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165704
SMART Domains Protein: ENSMUSP00000127783
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
RRM 336 405 1.84e-13 SMART
RRM 453 523 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165724
SMART Domains Protein: ENSMUSP00000130749
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_5 2 40 5.3e-7 PFAM
low complexity region 114 139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166593
Predicted Effect probably null
Transcript: ENSMUST00000167250
AA Change: K444*
SMART Domains Protein: ENSMUSP00000130695
Gene: ENSMUSG00000035835
AA Change: K444*

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
low complexity region 437 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167897
SMART Domains Protein: ENSMUSP00000127972
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168216
Predicted Effect probably benign
Transcript: ENSMUST00000168683
SMART Domains Protein: ENSMUSP00000132383
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
SCOP:d2u1a__ 17 55 3e-3 SMART
PDB:2AD9|A 18 55 9e-19 PDB
Blast:RRM 29 55 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168988
Predicted Effect probably benign
Transcript: ENSMUST00000169091
SMART Domains Protein: ENSMUSP00000128449
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 13 19 N/A INTRINSIC
Pfam:RRM_5 29 81 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169483
SMART Domains Protein: ENSMUSP00000127507
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171216
Predicted Effect probably benign
Transcript: ENSMUST00000171599
SMART Domains Protein: ENSMUSP00000131296
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 87 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172282
SMART Domains Protein: ENSMUSP00000126192
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 331 356 N/A INTRINSIC
RRM 362 431 1.84e-13 SMART
RRM 479 549 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184090
Meta Mutation Damage Score 0.6288 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteins in the lipid phosphate phosphatase (LPP) family, including PRG2, are integral membrane proteins that modulate bioactive lipid phosphates including phosphatidate, lysophosphatidate, and sphingosine-1-phosphate in the context of cell migration, neurite retraction, and mitogenesis (Brauer et al., 2003 [PubMed 12730698]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,706,150 N495S possibly damaging Het
Adamts7 G A 9: 90,178,278 probably null Het
Adora2a T A 10: 75,333,404 V234E probably damaging Het
Alpk1 T C 3: 127,686,316 D188G probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ankrd17 A G 5: 90,244,154 F1886L probably benign Het
Anks1 T G 17: 28,050,639 L769R probably damaging Het
Apol10a A G 15: 77,488,961 I266V probably benign Het
Arhgef28 T C 13: 97,985,388 Y556C probably damaging Het
Brd8 T A 18: 34,611,251 T175S probably damaging Het
Camsap2 C T 1: 136,281,199 V852I probably benign Het
Cd55b G T 1: 130,414,066 P278Q probably damaging Het
Cep290 T A 10: 100,531,166 S1126R possibly damaging Het
Cfh C T 1: 140,102,417 C906Y probably damaging Het
Chst13 C A 6: 90,309,278 R234L probably damaging Het
Clcn7 T C 17: 25,157,528 F611L probably benign Het
Cntnap1 A G 11: 101,184,615 D873G probably damaging Het
Cntnap5b T C 1: 100,164,146 I518T probably damaging Het
Col28a1 T C 6: 8,014,969 E812G probably damaging Het
Cpa1 T C 6: 30,640,954 I148T probably damaging Het
Cyp11a1 A G 9: 58,025,100 N232S probably benign Het
Dhrs13 A G 11: 78,032,693 D79G probably damaging Het
Disp1 T C 1: 183,087,148 E1236G possibly damaging Het
Dnah1 A C 14: 31,304,587 L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,585,024 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock9 A T 14: 121,562,080 I1729N probably damaging Het
Dysf T C 6: 84,137,266 V1192A possibly damaging Het
Enpp2 A G 15: 54,899,346 S169P probably damaging Het
Fam114a2 T G 11: 57,514,146 R43S probably damaging Het
Fam13a T C 6: 58,940,254 T546A probably benign Het
Fos A T 12: 85,475,686 D163V probably damaging Het
Fras1 T C 5: 96,764,946 Y3370H probably damaging Het
Fshr T C 17: 89,200,533 N27S probably null Het
Galnt6 A G 15: 100,693,424 S600P possibly damaging Het
Gars T A 6: 55,055,824 N260K probably damaging Het
Gpr158 C G 2: 21,815,611 P640A possibly damaging Het
Grik3 A G 4: 125,632,412 D146G probably benign Het
Hdac4 T C 1: 91,996,174 T205A probably benign Het
Kcnq3 T C 15: 66,004,794 D500G probably benign Het
Kmt5c A G 7: 4,746,481 K333E probably benign Het
Krt81 A G 15: 101,459,523 S443P probably benign Het
M6pr T C 6: 122,315,162 probably null Het
Mccc2 T A 13: 99,993,577 I91L probably benign Het
Nip7 A G 8: 107,058,423 D110G probably damaging Het
Nol8 T A 13: 49,676,353 F1093I probably damaging Het
Nrxn1 T C 17: 90,565,446 T1027A possibly damaging Het
Ofcc1 T A 13: 40,148,576 M495L probably benign Het
Olfr18 A G 9: 20,314,446 M158T probably benign Het
Olfr62 A T 4: 118,666,293 M259L probably benign Het
Pafah1b2 A T 9: 45,975,127 V81D probably damaging Het
Pcdhga4 A T 18: 37,685,913 S172C probably damaging Het
Pds5a A G 5: 65,656,296 V282A probably damaging Het
Plat A G 8: 22,772,266 D102G possibly damaging Het
Plce1 C A 19: 38,769,465 Q1961K probably damaging Het
Plscr3 A G 11: 69,847,646 probably null Het
Prtg A T 9: 72,906,186 T943S probably benign Het
Racgap1 A G 15: 99,623,953 F519L probably benign Het
Rbms2 A T 10: 128,151,181 probably null Het
Rfx7 A G 9: 72,616,955 T476A possibly damaging Het
Rnf150 T A 8: 83,083,502 L421Q possibly damaging Het
Sema3b A G 9: 107,600,920 L422P possibly damaging Het
Shank2 G A 7: 144,409,680 A921T probably benign Het
Skint3 A T 4: 112,255,875 E227D probably damaging Het
Slc25a19 G A 11: 115,617,560 R201C possibly damaging Het
Slc38a10 G T 11: 120,147,819 A40D probably damaging Het
Slc5a4b T C 10: 76,081,351 T284A probably benign Het
Smc1b A T 15: 85,127,623 F154I probably benign Het
Spry2 A T 14: 105,892,984 M256K possibly damaging Het
Stkld1 C T 2: 26,943,887 P129S probably damaging Het
Syce2 T C 8: 84,872,742 L13S possibly damaging Het
Tbc1d15 C A 10: 115,233,243 V74L possibly damaging Het
Tecpr2 T A 12: 110,944,751 V1074D probably damaging Het
Tex36 G A 7: 133,595,325 T21I probably benign Het
Ttn T G 2: 76,724,110 D30787A probably damaging Het
Ttn T A 2: 76,791,920 Q13710L probably benign Het
Usp34 T C 11: 23,412,260 F1569L possibly damaging Het
Vat1l C T 8: 114,371,651 A387V probably damaging Het
Vil1 G A 1: 74,421,311 G209D possibly damaging Het
Vmn1r113 G T 7: 20,787,867 D195Y probably damaging Het
Vmn2r69 A C 7: 85,415,591 I29R probably benign Het
Vti1b G A 12: 79,160,549 Q76* probably null Het
Zfp423 C A 8: 87,782,034 V540F possibly damaging Het
Zfp644 T C 5: 106,638,124 N186D probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp787 G A 7: 6,132,361 A297V probably damaging Het
Zfp827 G T 8: 79,060,695 Q163H probably damaging Het
Zfp955b T A 17: 33,303,186 V543E probably benign Het
Other mutations in Plppr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Plppr3 APN 10 79866669 missense probably damaging 1.00
IGL01108:Plppr3 APN 10 79867521 missense probably damaging 1.00
IGL01116:Plppr3 APN 10 79866923 missense probably damaging 1.00
IGL01362:Plppr3 APN 10 79865961 missense probably damaging 1.00
IGL03065:Plppr3 APN 10 79866046 missense probably benign 0.06
R0972:Plppr3 UTSW 10 79865086 missense probably damaging 0.99
R1508:Plppr3 UTSW 10 79867540 missense probably damaging 1.00
R1844:Plppr3 UTSW 10 79866410 critical splice donor site probably null
R1907:Plppr3 UTSW 10 79874069 missense probably damaging 1.00
R1982:Plppr3 UTSW 10 79866425 missense probably damaging 1.00
R1984:Plppr3 UTSW 10 79867460 nonsense probably null
R1985:Plppr3 UTSW 10 79867460 nonsense probably null
R2116:Plppr3 UTSW 10 79865738 missense probably benign 0.01
R2355:Plppr3 UTSW 10 79865360 missense possibly damaging 0.81
R4092:Plppr3 UTSW 10 79867480 missense probably damaging 1.00
R4572:Plppr3 UTSW 10 79866063 missense probably benign 0.03
R4685:Plppr3 UTSW 10 79867525 missense probably damaging 1.00
R4824:Plppr3 UTSW 10 79865673 missense possibly damaging 0.81
R5102:Plppr3 UTSW 10 79865386 missense possibly damaging 0.84
R5212:Plppr3 UTSW 10 79862445 missense probably benign 0.00
R5584:Plppr3 UTSW 10 79866452 missense probably damaging 1.00
R5684:Plppr3 UTSW 10 79865317 missense possibly damaging 0.81
R5778:Plppr3 UTSW 10 79866503 missense possibly damaging 0.78
R5954:Plppr3 UTSW 10 79866126 missense probably benign 0.05
R6357:Plppr3 UTSW 10 79865406 missense probably benign 0.06
R7134:Plppr3 UTSW 10 79865703 missense probably damaging 0.96
X0067:Plppr3 UTSW 10 79865284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TAACAGGCACCACTCCTTGC -3'
(R):5'- CAGGTTCATGATGATGAAGTTGTC -3'

Sequencing Primer
(F):5'- AGTCCTTAGTCTCAGCCGCAG -3'
(R):5'- GTCAGGATGTTAATATTCAAGGGC -3'
Posted On2018-04-02