Incidental Mutation 'R6306:Enpp2'
ID509699
Institutional Source Beutler Lab
Gene Symbol Enpp2
Ensembl Gene ENSMUSG00000022425
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 2
SynonymsPdnp2, Npps2, PD-Ialpha, ATX, Autotaxin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6306 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location54838901-54952892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54899346 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 169 (S169P)
Ref Sequence ENSEMBL: ENSMUSP00000133877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041591] [ENSMUST00000167541] [ENSMUST00000171545] [ENSMUST00000173516] [ENSMUST00000228222]
Predicted Effect probably damaging
Transcript: ENSMUST00000041591
AA Change: S169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036180
Gene: ENSMUSG00000022425
AA Change: S169P

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 4.7e-41 PFAM
Pfam:Phosphodiest 278 477 3.3e-40 PFAM
Endonuclease_NS 613 844 3.93e-36 SMART
NUC 614 844 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167541
AA Change: S169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132640
Gene: ENSMUSG00000022425
AA Change: S169P

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 284 5.4e-41 PFAM
Pfam:Phosphodiest 278 477 3.4e-40 PFAM
Endonuclease_NS 638 869 3.93e-36 SMART
NUC 639 869 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171545
AA Change: S169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128941
Gene: ENSMUSG00000022425
AA Change: S169P

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 283 2.8e-43 PFAM
Pfam:Phosphodiest 275 529 2.8e-36 PFAM
Endonuclease_NS 665 896 3.93e-36 SMART
NUC 666 896 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173516
AA Change: S169P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133877
Gene: ENSMUSG00000022425
AA Change: S169P

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 2.8e-41 PFAM
Pfam:Phosphodiest 276 529 7.8e-36 PFAM
Endonuclease_NS 661 892 3.93e-36 SMART
NUC 662 892 1.32e-109 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227483
Predicted Effect probably benign
Transcript: ENSMUST00000228222
Meta Mutation Damage Score 0.478 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: This gene encodes a member of the phosphodiesterase and nucleotide pyrophosphatase family of bifunctional enzymes that hydrolize phosphodiester bonds of various nucleotides. The encoded protein undergoes proteolytic processing to generate a mature protein with lysophospholipase D activity, catalyzing the cleavage of the choline group from lysophosphatidylcholine to produce lysophosphatidic acid. This gene is expressed in numerous tissues and participates in neural development, obesity, inflammation and oncogenesis. A complete lack of the encoded protein in mice results in aberrant vascular and neuronal development leading to embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, absent yolk sac vasculature, abnormal vasculature, and variable penetrance of impaired embryo turning, edema, failure of chorioallantoic fusion, neural tube malformations, and abnormal forebrain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,706,150 N495S possibly damaging Het
Adamts7 G A 9: 90,178,278 probably null Het
Adora2a T A 10: 75,333,404 V234E probably damaging Het
Alpk1 T C 3: 127,686,316 D188G probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ankrd17 A G 5: 90,244,154 F1886L probably benign Het
Anks1 T G 17: 28,050,639 L769R probably damaging Het
Apol10a A G 15: 77,488,961 I266V probably benign Het
Arhgef28 T C 13: 97,985,388 Y556C probably damaging Het
Brd8 T A 18: 34,611,251 T175S probably damaging Het
Camsap2 C T 1: 136,281,199 V852I probably benign Het
Cd55b G T 1: 130,414,066 P278Q probably damaging Het
Cep290 T A 10: 100,531,166 S1126R possibly damaging Het
Cfh C T 1: 140,102,417 C906Y probably damaging Het
Chst13 C A 6: 90,309,278 R234L probably damaging Het
Clcn7 T C 17: 25,157,528 F611L probably benign Het
Cntnap1 A G 11: 101,184,615 D873G probably damaging Het
Cntnap5b T C 1: 100,164,146 I518T probably damaging Het
Col28a1 T C 6: 8,014,969 E812G probably damaging Het
Cpa1 T C 6: 30,640,954 I148T probably damaging Het
Cyp11a1 A G 9: 58,025,100 N232S probably benign Het
Dhrs13 A G 11: 78,032,693 D79G probably damaging Het
Disp1 T C 1: 183,087,148 E1236G possibly damaging Het
Dnah1 A C 14: 31,304,587 L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,585,024 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock9 A T 14: 121,562,080 I1729N probably damaging Het
Dysf T C 6: 84,137,266 V1192A possibly damaging Het
Fam114a2 T G 11: 57,514,146 R43S probably damaging Het
Fam13a T C 6: 58,940,254 T546A probably benign Het
Fos A T 12: 85,475,686 D163V probably damaging Het
Fras1 T C 5: 96,764,946 Y3370H probably damaging Het
Fshr T C 17: 89,200,533 N27S probably null Het
Galnt6 A G 15: 100,693,424 S600P possibly damaging Het
Gars T A 6: 55,055,824 N260K probably damaging Het
Gpr158 C G 2: 21,815,611 P640A possibly damaging Het
Grik3 A G 4: 125,632,412 D146G probably benign Het
Hdac4 T C 1: 91,996,174 T205A probably benign Het
Kcnq3 T C 15: 66,004,794 D500G probably benign Het
Kmt5c A G 7: 4,746,481 K333E probably benign Het
Krt81 A G 15: 101,459,523 S443P probably benign Het
M6pr T C 6: 122,315,162 probably null Het
Mccc2 T A 13: 99,993,577 I91L probably benign Het
Nip7 A G 8: 107,058,423 D110G probably damaging Het
Nol8 T A 13: 49,676,353 F1093I probably damaging Het
Nrxn1 T C 17: 90,565,446 T1027A possibly damaging Het
Ofcc1 T A 13: 40,148,576 M495L probably benign Het
Olfr18 A G 9: 20,314,446 M158T probably benign Het
Olfr62 A T 4: 118,666,293 M259L probably benign Het
Pafah1b2 A T 9: 45,975,127 V81D probably damaging Het
Pcdhga4 A T 18: 37,685,913 S172C probably damaging Het
Pds5a A G 5: 65,656,296 V282A probably damaging Het
Plat A G 8: 22,772,266 D102G possibly damaging Het
Plce1 C A 19: 38,769,465 Q1961K probably damaging Het
Plppr3 T A 10: 79,861,732 K444* probably null Het
Plscr3 A G 11: 69,847,646 probably null Het
Prtg A T 9: 72,906,186 T943S probably benign Het
Racgap1 A G 15: 99,623,953 F519L probably benign Het
Rbms2 A T 10: 128,151,181 probably null Het
Rfx7 A G 9: 72,616,955 T476A possibly damaging Het
Rnf150 T A 8: 83,083,502 L421Q possibly damaging Het
Sema3b A G 9: 107,600,920 L422P possibly damaging Het
Shank2 G A 7: 144,409,680 A921T probably benign Het
Skint3 A T 4: 112,255,875 E227D probably damaging Het
Slc25a19 G A 11: 115,617,560 R201C possibly damaging Het
Slc38a10 G T 11: 120,147,819 A40D probably damaging Het
Slc5a4b T C 10: 76,081,351 T284A probably benign Het
Smc1b A T 15: 85,127,623 F154I probably benign Het
Spry2 A T 14: 105,892,984 M256K possibly damaging Het
Stkld1 C T 2: 26,943,887 P129S probably damaging Het
Syce2 T C 8: 84,872,742 L13S possibly damaging Het
Tbc1d15 C A 10: 115,233,243 V74L possibly damaging Het
Tecpr2 T A 12: 110,944,751 V1074D probably damaging Het
Tex36 G A 7: 133,595,325 T21I probably benign Het
Ttn T G 2: 76,724,110 D30787A probably damaging Het
Ttn T A 2: 76,791,920 Q13710L probably benign Het
Usp34 T C 11: 23,412,260 F1569L possibly damaging Het
Vat1l C T 8: 114,371,651 A387V probably damaging Het
Vil1 G A 1: 74,421,311 G209D possibly damaging Het
Vmn1r113 G T 7: 20,787,867 D195Y probably damaging Het
Vmn2r69 A C 7: 85,415,591 I29R probably benign Het
Vti1b G A 12: 79,160,549 Q76* probably null Het
Zfp423 C A 8: 87,782,034 V540F possibly damaging Het
Zfp644 T C 5: 106,638,124 N186D probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp787 G A 7: 6,132,361 A297V probably damaging Het
Zfp827 G T 8: 79,060,695 Q163H probably damaging Het
Zfp955b T A 17: 33,303,186 V543E probably benign Het
Other mutations in Enpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Enpp2 APN 15 54875650 critical splice donor site probably null
IGL01290:Enpp2 APN 15 54919602 missense possibly damaging 0.79
IGL01296:Enpp2 APN 15 54875669 missense probably damaging 1.00
IGL01650:Enpp2 APN 15 54919933 missense probably benign
IGL02470:Enpp2 APN 15 54839460 missense probably damaging 1.00
IGL02522:Enpp2 APN 15 54898940 missense probably damaging 0.99
IGL02727:Enpp2 APN 15 54910181 missense probably damaging 1.00
IGL03178:Enpp2 APN 15 54866006 missense probably benign
IGL03055:Enpp2 UTSW 15 54866085 intron probably null
PIT4260001:Enpp2 UTSW 15 54844378 critical splice donor site probably null
R0302:Enpp2 UTSW 15 54860061 missense probably benign 0.15
R0304:Enpp2 UTSW 15 54877806 missense probably benign 0.07
R0385:Enpp2 UTSW 15 54882159 missense probably damaging 1.00
R0440:Enpp2 UTSW 15 54847237 splice site probably benign
R0696:Enpp2 UTSW 15 54897696 nonsense probably null
R0879:Enpp2 UTSW 15 54877930 missense probably damaging 0.98
R0924:Enpp2 UTSW 15 54906959 splice site probably benign
R0989:Enpp2 UTSW 15 54875759 missense possibly damaging 0.88
R1126:Enpp2 UTSW 15 54906826 critical splice donor site probably null
R1434:Enpp2 UTSW 15 54862681 missense probably damaging 1.00
R1447:Enpp2 UTSW 15 54919598 critical splice donor site probably null
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1501:Enpp2 UTSW 15 54839514 missense probably damaging 1.00
R1546:Enpp2 UTSW 15 54845829 missense probably benign 0.01
R1673:Enpp2 UTSW 15 54910196 splice site probably null
R1853:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1854:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1855:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1969:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R1970:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R2060:Enpp2 UTSW 15 54875714 missense probably damaging 1.00
R2122:Enpp2 UTSW 15 54897792 nonsense probably null
R2275:Enpp2 UTSW 15 54897794 missense probably damaging 1.00
R2517:Enpp2 UTSW 15 54919694 missense probably damaging 0.99
R3881:Enpp2 UTSW 15 54919692 missense probably damaging 1.00
R3934:Enpp2 UTSW 15 54845921 missense probably benign 0.03
R4722:Enpp2 UTSW 15 54887589 missense probably damaging 0.99
R4765:Enpp2 UTSW 15 54875672 missense possibly damaging 0.91
R4799:Enpp2 UTSW 15 54910094 missense probably damaging 1.00
R4934:Enpp2 UTSW 15 54882147 missense probably damaging 1.00
R4976:Enpp2 UTSW 15 54870305 nonsense probably null
R5068:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5069:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5070:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5119:Enpp2 UTSW 15 54870305 nonsense probably null
R5134:Enpp2 UTSW 15 54899330 missense probably damaging 1.00
R5162:Enpp2 UTSW 15 54847296 missense probably benign 0.06
R5218:Enpp2 UTSW 15 54887586 missense possibly damaging 0.86
R5415:Enpp2 UTSW 15 54882156 missense probably damaging 1.00
R5965:Enpp2 UTSW 15 54882971 critical splice donor site probably null
R6086:Enpp2 UTSW 15 54845834 missense probably damaging 1.00
R6229:Enpp2 UTSW 15 54877832 missense probably damaging 1.00
R6314:Enpp2 UTSW 15 54865970 missense probably damaging 0.99
R6403:Enpp2 UTSW 15 54863764 missense probably damaging 1.00
R6515:Enpp2 UTSW 15 54860093 missense possibly damaging 0.75
R6525:Enpp2 UTSW 15 54870211 missense probably benign 0.01
R6536:Enpp2 UTSW 15 54862631 missense probably damaging 1.00
R7070:Enpp2 UTSW 15 54899289 missense probably damaging 1.00
R7077:Enpp2 UTSW 15 54901391 missense probably benign 0.36
R7265:Enpp2 UTSW 15 54910033 critical splice donor site probably null
R7324:Enpp2 UTSW 15 54877774 critical splice donor site probably null
R7331:Enpp2 UTSW 15 54875670 missense probably damaging 1.00
R7452:Enpp2 UTSW 15 54866736 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCCAGAACTGCTTCATGC -3'
(R):5'- TTGCCTCAAGTGCTATGTGG -3'

Sequencing Primer
(F):5'- TCATGCATAAAATTCATTTTCTCAGC -3'
(R):5'- CTATGTGGTTGGGAGCCC -3'
Posted On2018-04-02