Incidental Mutation 'R6306:Galnt6'
ID509705
Institutional Source Beutler Lab
Gene Symbol Galnt6
Ensembl Gene ENSMUSG00000037280
Gene Namepolypeptide N-acetylgalactosaminyltransferase 6
SynonymsGalNAc-T6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R6306 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location100691813-100729376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100693424 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 600 (S600P)
Ref Sequence ENSEMBL: ENSMUSP00000124793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052069] [ENSMUST00000159715] [ENSMUST00000161514]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052069
AA Change: S600P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056705
Gene: ENSMUSG00000037280
AA Change: S600P

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159715
AA Change: S600P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123848
Gene: ENSMUSG00000037280
AA Change: S600P

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 432 1e-10 PFAM
Pfam:Glycos_transf_2 180 366 4.1e-31 PFAM
Pfam:Glyco_transf_7C 337 415 6.7e-13 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160960
Predicted Effect possibly damaging
Transcript: ENSMUST00000161514
AA Change: S600P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124793
Gene: ENSMUSG00000037280
AA Change: S600P

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229410
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. The encoded protein is capable of glycosylating fibronectin peptide in vitro and is expressed in a fibroblast cell line, indicating that it may be involved in the synthesis of oncofetal fibronectin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik T C 17: 23,706,150 N495S possibly damaging Het
Adamts7 G A 9: 90,178,278 probably null Het
Adora2a T A 10: 75,333,404 V234E probably damaging Het
Alpk1 T C 3: 127,686,316 D188G probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Ankrd17 A G 5: 90,244,154 F1886L probably benign Het
Anks1 T G 17: 28,050,639 L769R probably damaging Het
Apol10a A G 15: 77,488,961 I266V probably benign Het
Arhgef28 T C 13: 97,985,388 Y556C probably damaging Het
Brd8 T A 18: 34,611,251 T175S probably damaging Het
Camsap2 C T 1: 136,281,199 V852I probably benign Het
Cd55b G T 1: 130,414,066 P278Q probably damaging Het
Cep290 T A 10: 100,531,166 S1126R possibly damaging Het
Cfh C T 1: 140,102,417 C906Y probably damaging Het
Chst13 C A 6: 90,309,278 R234L probably damaging Het
Clcn7 T C 17: 25,157,528 F611L probably benign Het
Cntnap1 A G 11: 101,184,615 D873G probably damaging Het
Cntnap5b T C 1: 100,164,146 I518T probably damaging Het
Col28a1 T C 6: 8,014,969 E812G probably damaging Het
Cpa1 T C 6: 30,640,954 I148T probably damaging Het
Cyp11a1 A G 9: 58,025,100 N232S probably benign Het
Dhrs13 A G 11: 78,032,693 D79G probably damaging Het
Disp1 T C 1: 183,087,148 E1236G possibly damaging Het
Dnah1 A C 14: 31,304,587 L778R probably damaging Het
Dnah14 CTGTG CTG 1: 181,585,024 probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock9 A T 14: 121,562,080 I1729N probably damaging Het
Dysf T C 6: 84,137,266 V1192A possibly damaging Het
Enpp2 A G 15: 54,899,346 S169P probably damaging Het
Fam114a2 T G 11: 57,514,146 R43S probably damaging Het
Fam13a T C 6: 58,940,254 T546A probably benign Het
Fos A T 12: 85,475,686 D163V probably damaging Het
Fras1 T C 5: 96,764,946 Y3370H probably damaging Het
Fshr T C 17: 89,200,533 N27S probably null Het
Gars T A 6: 55,055,824 N260K probably damaging Het
Gpr158 C G 2: 21,815,611 P640A possibly damaging Het
Grik3 A G 4: 125,632,412 D146G probably benign Het
Hdac4 T C 1: 91,996,174 T205A probably benign Het
Kcnq3 T C 15: 66,004,794 D500G probably benign Het
Kmt5c A G 7: 4,746,481 K333E probably benign Het
Krt81 A G 15: 101,459,523 S443P probably benign Het
M6pr T C 6: 122,315,162 probably null Het
Mccc2 T A 13: 99,993,577 I91L probably benign Het
Nip7 A G 8: 107,058,423 D110G probably damaging Het
Nol8 T A 13: 49,676,353 F1093I probably damaging Het
Nrxn1 T C 17: 90,565,446 T1027A possibly damaging Het
Ofcc1 T A 13: 40,148,576 M495L probably benign Het
Olfr18 A G 9: 20,314,446 M158T probably benign Het
Olfr62 A T 4: 118,666,293 M259L probably benign Het
Pafah1b2 A T 9: 45,975,127 V81D probably damaging Het
Pcdhga4 A T 18: 37,685,913 S172C probably damaging Het
Pds5a A G 5: 65,656,296 V282A probably damaging Het
Plat A G 8: 22,772,266 D102G possibly damaging Het
Plce1 C A 19: 38,769,465 Q1961K probably damaging Het
Plppr3 T A 10: 79,861,732 K444* probably null Het
Plscr3 A G 11: 69,847,646 probably null Het
Prtg A T 9: 72,906,186 T943S probably benign Het
Racgap1 A G 15: 99,623,953 F519L probably benign Het
Rbms2 A T 10: 128,151,181 probably null Het
Rfx7 A G 9: 72,616,955 T476A possibly damaging Het
Rnf150 T A 8: 83,083,502 L421Q possibly damaging Het
Sema3b A G 9: 107,600,920 L422P possibly damaging Het
Shank2 G A 7: 144,409,680 A921T probably benign Het
Skint3 A T 4: 112,255,875 E227D probably damaging Het
Slc25a19 G A 11: 115,617,560 R201C possibly damaging Het
Slc38a10 G T 11: 120,147,819 A40D probably damaging Het
Slc5a4b T C 10: 76,081,351 T284A probably benign Het
Smc1b A T 15: 85,127,623 F154I probably benign Het
Spry2 A T 14: 105,892,984 M256K possibly damaging Het
Stkld1 C T 2: 26,943,887 P129S probably damaging Het
Syce2 T C 8: 84,872,742 L13S possibly damaging Het
Tbc1d15 C A 10: 115,233,243 V74L possibly damaging Het
Tecpr2 T A 12: 110,944,751 V1074D probably damaging Het
Tex36 G A 7: 133,595,325 T21I probably benign Het
Ttn T G 2: 76,724,110 D30787A probably damaging Het
Ttn T A 2: 76,791,920 Q13710L probably benign Het
Usp34 T C 11: 23,412,260 F1569L possibly damaging Het
Vat1l C T 8: 114,371,651 A387V probably damaging Het
Vil1 G A 1: 74,421,311 G209D possibly damaging Het
Vmn1r113 G T 7: 20,787,867 D195Y probably damaging Het
Vmn2r69 A C 7: 85,415,591 I29R probably benign Het
Vti1b G A 12: 79,160,549 Q76* probably null Het
Zfp423 C A 8: 87,782,034 V540F possibly damaging Het
Zfp644 T C 5: 106,638,124 N186D probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp787 G A 7: 6,132,361 A297V probably damaging Het
Zfp827 G T 8: 79,060,695 Q163H probably damaging Het
Zfp955b T A 17: 33,303,186 V543E probably benign Het
Other mutations in Galnt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:Galnt6 APN 15 100703493 missense probably benign 0.16
IGL02606:Galnt6 APN 15 100714219 missense probably damaging 1.00
R0325:Galnt6 UTSW 15 100693471 splice site probably null
R0336:Galnt6 UTSW 15 100699206 missense probably damaging 0.99
R0504:Galnt6 UTSW 15 100696657 splice site probably benign
R1563:Galnt6 UTSW 15 100703378 missense probably benign 0.00
R1903:Galnt6 UTSW 15 100716118 missense possibly damaging 0.79
R2007:Galnt6 UTSW 15 100697166 missense probably damaging 1.00
R2114:Galnt6 UTSW 15 100714241 missense probably damaging 1.00
R2943:Galnt6 UTSW 15 100714279 splice site probably null
R3410:Galnt6 UTSW 15 100699137 missense probably damaging 1.00
R3954:Galnt6 UTSW 15 100697168 missense possibly damaging 0.72
R4754:Galnt6 UTSW 15 100699224 missense probably damaging 1.00
R4910:Galnt6 UTSW 15 100716178 missense probably benign
R4911:Galnt6 UTSW 15 100716178 missense probably benign
R4962:Galnt6 UTSW 15 100696574 nonsense probably null
R5237:Galnt6 UTSW 15 100693393 missense probably damaging 1.00
R5293:Galnt6 UTSW 15 100703501 missense probably benign 0.00
R5605:Galnt6 UTSW 15 100697225 missense probably damaging 1.00
R5752:Galnt6 UTSW 15 100704126 missense probably damaging 1.00
R5837:Galnt6 UTSW 15 100694646 missense possibly damaging 0.70
R5949:Galnt6 UTSW 15 100696550 missense probably damaging 1.00
R6051:Galnt6 UTSW 15 100694668 missense probably damaging 1.00
R6522:Galnt6 UTSW 15 100693355 makesense probably null
R6959:Galnt6 UTSW 15 100714125 missense probably damaging 0.99
R7154:Galnt6 UTSW 15 100693464 missense probably benign 0.05
R7450:Galnt6 UTSW 15 100697815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCAAAATCCAACTCTCAG -3'
(R):5'- CAGGCTAAAGCTGCTGTGTG -3'

Sequencing Primer
(F):5'- ACTCTCAGGCCTCCAGAG -3'
(R):5'- GGCCCCAGTTTAACCCT -3'
Posted On2018-04-02