Incidental Mutation 'R6311:Slc9a8'
ID509761
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6311 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167451220 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 163 (S163T)
Ref Sequence ENSEMBL: ENSMUSP00000104841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably damaging
Transcript: ENSMUST00000047815
AA Change: S190T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: S190T

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073873
AA Change: S163T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: S163T

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109218
AA Change: S163T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: S163T

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155585
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 A G 13: 68,625,792 I1044T probably damaging Het
Arhgef4 T G 1: 34,723,981 F773V unknown Het
B4galnt4 A G 7: 141,068,659 N696S probably damaging Het
Cdh16 T A 8: 104,614,433 D786V probably benign Het
Cdh8 T C 8: 99,400,895 Y28C probably damaging Het
Cgn C T 3: 94,778,176 probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chst10 A G 1: 38,868,047 V174A probably damaging Het
Clca4a T A 3: 144,966,413 N256I probably damaging Het
Cntnap5a G A 1: 116,412,106 W698* probably null Het
Ddx24 C A 12: 103,423,907 R275L probably damaging Het
Dnmt3b G T 2: 153,674,005 G444V probably damaging Het
Ermn A G 2: 58,051,759 F109S probably damaging Het
Fam227a C T 15: 79,640,694 A190T probably benign Het
Fstl4 T C 11: 53,176,977 W556R probably damaging Het
Fut2 T A 7: 45,650,380 I323F possibly damaging Het
Grik2 T G 10: 49,578,138 K94Q probably damaging Het
Hsd3b5 T C 3: 98,630,090 R37G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kmt2c A G 5: 25,443,818 probably null Het
Lrriq1 A T 10: 103,173,393 D1076E probably benign Het
Mical2 T A 7: 112,323,558 I590N probably damaging Het
Mycbp2 A G 14: 103,262,740 L940P possibly damaging Het
Nr6a1 T C 2: 38,739,071 I257V possibly damaging Het
Olfr1452-ps1 T A 19: 13,016,571 M116K probably damaging Het
Olfr812 A G 10: 129,842,907 L45P possibly damaging Het
Pcdhb17 A T 18: 37,486,263 probably null Het
Pdcl3 A G 1: 38,987,844 M1V probably null Het
Pdzd2 T A 15: 12,458,188 E196D probably damaging Het
Pgm1 G A 5: 64,116,415 C581Y probably benign Het
Pgm2 T C 4: 99,970,040 F379S possibly damaging Het
Plbd1 T A 6: 136,613,947 H407L probably benign Het
Prdm12 A G 2: 31,654,309 Y308C probably benign Het
Prdm15 T C 16: 97,799,055 E893G probably null Het
Slc17a2 A G 13: 23,815,022 T133A probably benign Het
Sult2a3 T C 7: 14,111,557 I126V probably benign Het
Tlr1 C T 5: 64,926,845 D130N probably damaging Het
Ugt3a2 A T 15: 9,361,518 K127* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167474131 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACAGAGTGTGGTGCAGCTG -3'
(R):5'- AGTTGACCACATAGGGACCAG -3'

Sequencing Primer
(F):5'- GGAAACCAGGCTCAGCACTG -3'
(R):5'- ACATAGGGACCAGCCTGTGTG -3'
Posted On2018-04-02